정보

유전자 서열에서 코딩 영역을 어떻게 얻을 수 있습니까?

유전자 서열에서 코딩 영역을 어떻게 얻을 수 있습니까?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

그래서 저는 600개 이상의 유전자 서열이 있는 파일을 가지고 있으며, 각각 다른 집단에서 유래했습니다. 이 파일은 유전자 서열에 대해 염색체 서열을 블라스팅한 후 얻은 것입니다. 그러나 코딩 영역도 필요합니다. 똑같이 하고 엑손에 대해 염색체를 블라스트해야 합니까, 아니면 엑손에 대해 유전자 서열을 블라스트해야 합니까?


모든 엑손 시퀀스가 ​​코딩되는 것은 아닙니다. 끝 부분에는 3' 및 5' UTR이 있습니다.

귀하의 유기체에 대한 gtfs를 찾을 수 있습니까? 그것들은 작업하기 더 쉬울 것입니다.

또는 단백질에 대해 blastx를 수행하여 단백질을 코딩하는 서열만 추출해야 합니다.


NCBI 생물정보학 리소스: 소개: 서열 찾기

물체: 유기체와 단백질로 시작하여 단백질 서열과 유전자 코딩 영역을 찾습니다.

예시: 병원성 인자에 대한 단백질 서열 및 유전자 코딩 영역 찾기 리스테리오리신 O 박테리아로부터 리스테리아 모노사이토제네스.

유전자 및 단백질 정보 검색

에서 검색 시작 유전자, Protein보다 중복성이 적기 때문입니다(Protein에서 이 동일한 검색은 700개 이상의 레코드를 검색함).

찾다: Listeria monocytogenes[유기체] AND 리스테리오리신 O[단백질 이름]

유전자 기호에 대한 하나의 레코드 , 검색됩니다. 이는 NC_ 수탁 번호와 연관됩니다(일반적으로 참조 어셈블리인 완전한 게놈 분자를 지정하면 RefSeq 수탁 번호 및 분자 유형 참조).

찾기 위해 유전자 코딩 서열, 을보세요 게놈 영역, 전사체 및 제품 섹션 또는 NCBI 참조 시퀀스(RefSeq) 유전자 기록 섹션:

클릭하면 젠뱅크 링크는 GenBank 레코드를 표시합니다. 뉴클레오티드 데이터 베이스. NS 코딩 시퀀스 hly 유전자는 아래에서 찾을 수 있습니다. CDS 에서 특징 레코드 섹션(빨간색으로 윤곽선):

이 유전자에 대한 GenBank 기록은 염색체 상의 위치와 번역된 단백질 서열 (파란색으로 표시됨). 단백질 서열은 또한 뉴클레오타이드 기록 또는 참조 시퀀스 유전자 레코드의 섹션.


인간 참조 유전자 세트

2001년 인간 게놈 서열 초안이 발표된 이후[6, 7], 컴퓨터 예측 또는 수동 주석 또는 두 가지 방법의 혼합을 사용하여 많은 인간 유전자 참조 세트가 생성되었습니다. Ensembl 프로젝트는 처음에 공개 인간 게놈 프로젝트의 일부로 생성되는 대량의 미완성 게놈 데이터를 보관하고 주석을 달고 서열과 주석 모두에 대한 브라우저 용량을 제공하도록 설정되었습니다(그림 2). Ensembl은 확장되어 이제 35개 이상의 종에 대한 자동 예측을 생성합니다. Ensembl 유전자 구축 프로세스는 단백질과 cDNA 서열의 정렬을 기반으로 하여 낮은 가양성률로 매우 정확한 유전자 세트를 생성합니다[19].

앙상블 브라우저. Ensembl 브라우저의 ContigView 페이지는 SPAG4 인코딩 영역 ENr333 내의 염색체 20에 있는 유전자 좌. (NS) 녹색 성적표는 CCDS 컨소시엄에서 동의한 CCDS 코딩 영역을 나타냅니다. (NS) 파란색 성적표는 HAVANA 그룹에서 수동으로 주석을 추가한 Vega 성적표이며 코딩(단색 파란색) 및 비코딩(파란색 윤곽선) 성적표가 혼합되어 있습니다. (씨) 마지막으로 골드 트랜스크립트는 HAVANA와 Ensembl 주석이 일치하는 코딩 트랜스크립트를 나타냅니다.

다수의 게놈에 대한 서열 및 주석 데이터를 제공하는 또 다른 게놈 브라우저는 UCSC(University of California, Santa Cruz) 게놈 브라우저 데이터베이스[20]입니다. 2007년 4월 UCSC는 인간 게놈에 대한 'Known Gene Set'의 개선된 버전을 출시했으며 여기에는 단백질 코딩 유전자뿐만 아니라 추정되는 비암호화 RNA도 포함되었습니다. 이 세트의 각 항목에는 다른 증거가 필요하지 않은 선별된 cDNA를 제외하고 GenBank 항목과 최소한 하나의 다른 증거 라인의 지원이 필요합니다.

수동 주석은 고품질의 완성된 게놈에 주석을 추가하는 데 여전히 중요한 역할을 합니다. 현재 NCBI(National Center for Biotechnology Information) 참조 염기서열(RefSeq) 컬렉션은 식물, 바이러스, 척추동물 및 무척추동물 염기서열을 포함한 다종 전사체의 고도로(수동으로) 선별된 리소스를 제공합니다[21, 22]. 이들은 이름에서 알 수 있듯이 전사 지향적이며 신뢰할 수 있는 큐레이션을 위해 일반적으로 전장 cDNA에 의존하지만, 데이터세트에는 Gnomon 예측 프로그램을 사용하여 게놈 서열에 대해 정렬된 부분 cDNA 및 EST(expressed sequence tags)를 사용한 예측도 포함되어 있습니다. ]. 수동으로 검토된 RefSeq 뉴클레오티드 서열은 참조 NM 식별자로 시작하는 반면 검토되지 않은 예측에는 XM 식별자가 있습니다. 새로운 게놈이 처음 시퀀싱될 때 RefSeq가 국제적으로 게놈 주석의 표준으로 사용되기 때문에 연구자들은 일반적으로 RefSeq 데이터 세트를 사용하여 누락된 유전자를 식별하거나 유전자 내 게놈 재배열을 식별합니다[21]. RefSeq는 매우 신뢰할 수 있지만 보수적인 유전자 참조 세트입니다. 다른 참조 세트에는 일반적으로 RefSeq가 포함되지만 상당히 확장됩니다. 예를 들어, UCSC 'Known Genes'에는 10% 더 많은 단백질 코딩 유전자, RefSeq보다 약 5배 많은 추정 코딩 유전자 및 2배 많은 스플라이스 변이체가 있습니다.

수동 유전자 주석에 대한 다른 접근 방식은 게놈에 정렬된 전사체에 주석을 달고 cDNA가 아닌 게놈 서열을 참조로 사용하는 것입니다. 이것이 Wellcome Trust Sanger Institute의 HAVANA 그룹이 척추동물 서열에 대한 주석을 생성하는 방법입니다. 현재 인간, 생쥐, 제브라피쉬 등 3가지 척추동물 게놈만이 완전히 완성되고 수동 주석이 필요한 품질로 시퀀싱되고 있다[24]. 완성된 게놈 서열은 변형된 Ensembl 파이프라인[25]을 사용하여 분석되고, 다양한 cDNA/EST 및 단백질의 BLAST 결과 ab 시작 예측은 주석 브라우저 도구 Otterlace에서 수동으로 분석할 수 있습니다. cDNA 주석과 비교하여 게놈 주석의 장점은 부분 EST 증거 및 단백질 증거를 사용할 수 있는 반면 cDNA 주석은 전체 길이 전사체의 가용성으로 제한되므로 더 많은 대체 접합 변이체를 예측할 수 있다는 것입니다. 더욱이, 게놈 주석은 유사유전자에 대한 보다 포괄적인 분석을 생성합니다. 그러나 한 가지 단점은 참조 서열에서 다형성이 발생하면 코딩 전사체에 주석을 달 수 없는 반면 cDNA 주석은 주요 일배체형 형태를 선택할 수 있으므로 참조 서열에 의해 제한되지 않는다는 것입니다.

2006년에 위에서 언급한 그룹(NCBI(RefSeq), UCSC, Wellcome Trust Sanger Institute(HAVANA) 및 Ensembl)은 아직 공식적인 합의가 없었기 때문에 인간 참조 게놈에 대한 합의 유전자 세트를 생산하고 협력할 필요가 있음을 확인했습니다. 인간 단백질 코딩 유전자에 대한 다양한 데이터베이스. CCDS(Consensus Coding Sequence Set)[26]라고 하는 이 코드에는 현재 시작 코돈에서 종료 코돈까지 각 데이터베이스의 유전자 빌드에서 동일한 코딩 전사체만 포함되어 있습니다. 최신 인간 CCDS 릴리스(2008년 5월)에는 17,052개의 유전자를 나타내는 20,151개의 공통 코딩 서열이 포함되어 있습니다. 이것은 처음으로 연구원들에게 3개 그룹(Ensembl, NCBI 및 HAVANA)의 수동 및 자동 주석의 조합과 UCSC에서 품질을 확인하는 조합에서 독립적으로 파생된 일관되고 신뢰할 수 있는 유전자 세트를 제공합니다. 다른 그룹의 유전자 세트가 다르고 자동으로 병합될 수 없는 단백질 코딩 유전자는 수동으로 재검토되어 NCBI, UCSC 및 HAVANA 그룹의 만장일치 투표를 받으면 거부되거나 합의 세트에 추가됩니다. .

CCDS 프로젝트를 보완하는 것은 GENCODE 프로젝트[27]입니다. GENCODE 컨소시엄[28]은 초기에 인간 게놈 서열의 1%를 나타내는 ENCODE 프로젝트[29, 30]의 프레임워크에서 선택된 영역 내의 모든 단백질 코딩 유전자를 식별하고 매핑하기 위해 구성되었습니다. 이것은 HAVANA에 의한 초기 수동 주석, 계산 예측 및 실험적 검증, 그리고 이러한 실험 결과에 기초한 주석의 결과적인 개선의 조합에 의해 달성되었습니다. 이 프로젝트는 전체 참조 인간 게놈 서열에 주석을 달고 여러 추정 유전자좌를 실험적으로 검증하기 위해 2008년에 자금을 지원받았습니다. 확대된 주석에는 전사 증거에 의해 지원되는 pseudogenes 및 noncoding loci의 식별이 포함됩니다. 초기 수동 주석은 비교 분석 또는 새로운 기록 데이터를 기반으로 한 불일치를 강조하기 위해 자동화된 예측과 비교됩니다. 2011년에 완료되면 이 유전자 세트가 표준 인간 유전자 참조 세트가 될 것으로 예상됩니다.


질문: 아래 PCR에서 볼 수 있습니다. 그림 A: 제한 효소 부위의 위치가 있는 DNA 서열(첫 번째 ATG에서 마지막 TAA까지 800Nt) 그림 B: 플라스미드 DNA의 다중 복제 부위(MCS) 및 그림 C: 세 가지 공통 버퍼에서 나열된 제한 효소의 활동. 작업: 코딩 영역을 도입하기 위한 전략을 찾아야 합니다.

그림 C: 세 가지 일반적인 완충액에서 나열된 제한 효소의 활성.

작업: PCR 및 분자 복제 기술을 사용하여 유전자의 코딩 영역(첫 번째 ATG에서 마지막 TAA까지)을 벡터의 다중 복제 부위(MCS)에 도입하는 전략을 찾아야 합니다.

이 작업에는 다음이 필요합니다.

(작업 1) MCS에서 2개의 제한 효소를 선택하여 DNA 도입(5점)

(작업 2) 선택된 제한 부위의 서열을 포함하는 정방향 및 역방향 PCR 프라이머를 설계합니다(각 프라이머에 대해 10개 마크 = 총 20개 마크)

(작업 3) 두 프라이머의 Tm을 계산합니다(각각 5점, 총 10점).


질문: 유전자의 코딩 영역에서 다음 DNA 시퀀스를 고려하십시오. 5' – A T G A A G A G G A G T C C – 3' 3' – T A C T T T C T C C T C A G G – 5 1) 상단 가닥을 코딩 가닥으로 사용하는 경우 전사된 MRNA의 서열은 무엇입니까? 2) 유전자 코드를 사용하여 이 폴리펩티드의 아미노산 서열은 무엇입니까? 3) 점 돌연변이 .

유전자의 코딩 영역에서 다음 DNA 서열을 고려하십시오.

5' – A T G A A G NS G G A G T C C – 3'

3' – T A C T T T C T C C T C A G G – 5

1) 상단 가닥을 코딩 가닥으로 사용하여

2) 유전자 코드를 사용하여 이 폴리펩타이드의 아미노산 서열은 무엇입니까?

3) 밑줄 친 위치에서 점 돌연변이가 발생합니다. DNA 서열은

5' – A T G A A G G G A G T C C – 3'

3' – T A C T T T C G C C T C A G G – 5'

이 돌연변이는 단백질의 아미노산 서열에 어떤 영향을 줍니까? (새로운 아미노산 서열 쓰기)

4) 염기의 삽입은 a(n) ___________________________ 돌연변이를 유발합니다.


코딩, 코딩 서열 분석 및 유전자 예측

이 포괄적인 BAC 리소스를 검색하여 다양한 종에 대한 각 BAC에 대해 사용 가능한 매핑, 시퀀스, 주석 및 기능 데이터를 찾으십시오.

원핵생물 이동 유전 요소(MGE)를 검색하고 분류합니다.

진화 관련 유기체의 게놈 서열을 서로 비교하여 유전자를 예측합니다.

척추동물 mRNA 3'-untranslated region(UTR)의 Au-Rich 요소에 대한 정보를 찾으십시오.

일반화된 은닉 마르코프 모델을 기반으로 진핵생물 게놈 서열의 유전자를 예측합니다.

600개 이상의 완전히 시퀀싱된 미생물 게놈에 대한 대체 ORF의 검색 가능한 데이터베이스.

DNA 시퀀스에서 추정되는 박테리오신 오픈 리딩 프레임(ORF)을 예측합니다.

감소된 배경 노이즈로 통계적으로 유의미한 위치별 시퀀스 바이어스를 감지하고 표시합니다.

뉴클레오티드 시퀀스에서 벡터 오염을 찾습니다.

코딩 서열을 포함하는 것으로 의심되는 영역을 찾고 두 게놈 또는 유전자 서열 사이의 뉴클레오티드 다양성을 시각화합니다.

종간 게놈 비교를 통해 코딩 및 비코딩 보존 서열 태그를 식별합니다.

23093 유기체 목록(2004)에서 유기체의 코돈 사용 합계를 찾으십시오.

인간, 마우스 및 쥐 게놈에서 융합 서열을 검색합니다.

게놈 내 및 게놈 전반에서 동의어 코돈 사용 편향을 측정합니다.

긴 시퀀스에서 복잡성이 낮은 영역을 검색하고 정렬된 시퀀스 그룹의 복잡성을 추정합니다.

염기서열에서 CpG 섬을 찾습니다.

디뉴클레오티드 분자 특성에 대한 정보를 찾으십시오.

상동 서열의 비교 분석을 기반으로 진핵생물 유전자를 예측합니다.

예측된 원핵생물 오픈 리딩 프레임(ORF)을 예측하고 통계적으로 평가합니다.

NCBI 데이터베이스에서 유전자 관련 정보를 검색합니다.

GenBank 항목 및 기타 GenBank 형식 파일에서 시퀀스 및 기능 주석(예: 인트론/엑손 구조)을 추출합니다.

원핵생물 및 성숙한 진핵생물 서열에서 코딩 영역을 예측합니다.

유전자 알고리즘을 사용하여 최적의 코돈 선택을 위해 개발된 알고리즘입니다.

게놈 서명 패러다임을 기반으로 뉴클레오티드 서열을 특성화하고 분류합니다.

척추동물, 무척추동물 및 식물의 게놈 서열에서 유전자의 위치 및 엑손-인트론 구조를 예측합니다.

DNA 서열의 유전적(암호화/비암호화) 및 물리학(나선/코일) 분할을 비교합니다.

원핵생물, 진핵생물 및 바이러스 게놈 서열의 유전자를 예측합니다.

다양한 소프트웨어 도구를 사용하여 DNA 서열의 유전자를 예측합니다.

인간 내인성 레트로바이러스(HERV)에 대한 인간 게놈을 스크리닝합니다.

완전한 게놈에서 주석 처리된 유사유전자에 대한 정보를 검색합니다.

인간 게놈에서 감수 분열 재조합 반점을 검색하십시오.

ISfinder에서 원핵생물 게놈의 삽입 서열을 시각화합니다.

박테리아 삽입 서열(IS)을 검색합니다.

서열 데이터뱅크와 핵산 및 단백질 서열 분석의 다양한 도구에 대한 액세스.

원핵생물 게놈 DNA 서열에서 섬을 검색하고 관련 인테그라제의 계통발생을 분석합니다.

이종 단백질 합성을 개선하기 위해 발현 숙주에 표적 유전자 코돈 사용을 조정합니다.

게놈 서열에서 전장 LTR 레트로트랜스포존을 찾습니다.

생물학적 서열의 특징을 예측합니다.

완전히 시퀀싱된 원핵생물 게놈에서 추출된 비중복 미세위성을 검색합니다.

분자 수준에서 자연 선택의 특징을 감지합니다.

이 포괄적인 리소스에서 microRNA 표적 예측 및 발현 프로필을 찾으십시오.

뉴클레오타이드 서열에 존재하는 오픈 리딩 프레임(ORF)을 찾습니다.

차세대 시퀀싱 데이터에서 메틸화 데이터에 대한 정보를 찾으십시오.

뉴클레오솜 형성 부위의 위치 및 특성에 대한 실험 데이터를 검색합니다.

발현 수준을 증가시키기 위해 DNA 서열의 코돈 사용을 최적화하는 온라인 PHP 애플리케이션.

포유류 및 곰팡이에서 대량의 EST 또는 cDNA를 분석합니다.

진화하는 인간 및 마우스 ORF(Open Reading Frame) 클론(UltimateTM ORF 클론) 컬렉션을 검색합니다.

마이크로어레이 데이터의 클러스터 및 교차 종 분석을 위한 웹 플랫폼입니다.

EST(Expressed Sequence Tag) 유래 서열에서 단백질 코딩 영역을 식별합니다.

짧은 환경 DNA 서열에서 단백질 코딩 유전자를 예측합니다.

55종에서 예측된 ortholog 그룹을 검색합니다.

라이브러리를 사용하지 않고 반복을 위해 EST를 마스킹합니다.

게놈 내 L1 매개 삽입의 서명 결과를 점수화하여 역전이된 기원의 서열을 추적합니다.

게놈, 전사체 및 단백질을 나타내는 서열을 찾으십시오.

모든 동료 검토 연구에서 합성(인공적으로 조작된) 유전자에 대한 시퀀스 및 관련 실험 정보를 검색합니다.

인간 게놈에서 짧은 직렬 반복 DNA를 검색합니다.

처리량이 많은 시퀀스 데이터에 대한 분석을 수행합니다.

대체 성적표를 감지, 분석 및 시각화합니다.

이 포털 사이트에서 생물 정보학 도구 모음을 사용하십시오.

mRNA 전사체의 기능적 주석을 수행합니다.

전체 길이의 EST cDNA를 식별하고 EST cDNA에 기능적으로 주석을 추가합니다.

유전자 코드에 대한 포괄적인 정보를 검색합니다.

모바일 유전 요소의 비중복 분석 및 진화 기반 분류에 전념하는 진행 중인 데이터베이스입니다.

다른 진핵 생물에서 표현된 서열 태그(EST)의 주석이 달린 유전 정보를 검색합니다.

기원의 부모 효과가 보고된 동물 유전자 및 표현형에 대한 정보를 검색합니다.

게놈 서열에서 tRNA 유전자 및 snoRNA 유전자를 검색합니다.

TE의 특정 유형 및 패밀리, 게놈 및 mRNA 위치, 서열, 지원하는 전사체 접근 및 TE 공통 서열에 대한 정렬에 관한 정보를 포함합니다.

뉴클레오티드 서열에서 UTR 요소의 존재를 검색합니다.

쿼리 시퀀스에서 UTR 기능 요소를 검색합니다.

C. elegans에서 3'UTR 시퀀스, 그래픽 디스플레이, 예측 및 검증된 기능 요소, 2차 구조 예측 및 기타 세부 데이터를 포함하여 3'UTR 및 해당 기능 요소를 찾습니다.

80개의 게놈을 포함하는 단일 유전자 서열에 존재하는 미세 위성의 웹 기반 관계형 데이터베이스.

단일유전자 클러스터에 대한 매핑 및 발현 정보 찾기(각각 고유한 알려진 또는 추정되는 유전자를 나타내는 클러스터로 구성된 EST 및 전장 mRNA 서열)

핵산 서열에서 벡터 오염을 식별합니다.

지정된 종의 그룹에서 하나 이상의 게놈 라이브러리를 효율적으로 스크리닝하는 데 사용할 수 있는 보존된 서열에서 '보편적인' 과잉 하이브리드화 프로브를 식별하거나 설계하기 위한 공개 온라인 리소스입니다.

뉴클레오티드 시퀀스에서 벡터 시퀀스 오염 찾기

분자 생물학에서 일반적으로 사용되는 많은 벡터에 대한 주석 및 서열 정보를 검색합니다.

원시 EST 추적을 위한 공개 시퀀스 처리 서비스입니다.

GenBank에 포함된 모든 진핵생물 단백질 인코딩 DNA 서열을 검색하고 스플라이스 부위 및 인트론 단계에서 주석을 찾습니다.

포괄적인 microRNA 서열 데이터, 주석 및 예측된 유전자 표적을 검색합니다.

TE 유래 microRNA를 찾습니다.

변형 에너지 및 뉴클레오솜 포지셔닝 점수 계산기.

Human, Mouse, Rat, Drosophila의 piRNA에 대한 정보를 제공합니다.

혼합 숙주 cDNA 라이브러리에서 유래하는 발현된 서열 태그의 기원 분류를 위해 지원 벡터 기계를 사용하십시오.

건강 과학 도서관 시스템은 피츠버그 대학의 건강 과학을 지원합니다.

© 1996 - 2014 건강 과학 도서관 시스템, 피츠버그 대학교. 판권 소유.
웹마스터에게 문의


생물학 171

이 섹션이 끝나면 다음을 수행할 수 있습니다.

  • 유전자 조절에서 전사 인자의 역할 토론
  • 인핸서와 리프레서가 유전자 발현을 조절하는 방법 설명

원핵생물 세포와 마찬가지로 진핵생물에서 유전자의 전사는 전사를 개시하기 위해 유전자의 상류에 있는 DNA 서열에 결합하는 RNA 중합효소의 작용을 필요로 한다. 그러나, 원핵 세포와 달리, 진핵 RNA 중합효소는 전사 개시를 촉진하기 위해 다른 단백질 또는 전사 인자를 필요로 합니다. RNA 중합효소 자체는 진핵 세포에서 전사를 시작할 수 없습니다. 진핵생물의 전사를 조절하는 전사 인자에는 두 가지 유형이 있습니다. 일반(또는 기초) 전사 인자 핵심 프로모터 영역에 결합하여 RNA 중합효소의 결합을 돕습니다. 특정 전사 인자 코어 프로모터 영역 외부의 다양한 영역에 결합하고 코어 프로모터의 단백질과 상호작용하여 폴리머라제의 활성을 향상시키거나 억제한다.

전사 과정(비디오), 즉 DNA 주형에서 RNA를 만드는 과정을 봅니다.

프로모터와 전사 기계

유전자는 유전자 발현을 보다 쉽게 ​​제어할 수 있도록 구성되어 있습니다. 프로모터 영역은 코딩 서열의 바로 상류에 있습니다. 이 영역은 짧거나(단 몇 개의 뉴클레오티드 길이) 상당히 길 수 있습니다(수백 개의 뉴클레오티드 길이). 프로모터가 길수록 단백질이 결합할 수 있는 공간이 늘어납니다. 이것은 또한 전사 프로세스에 더 많은 제어를 추가합니다. 프로모터의 길이는 유전자 특이적이며 유전자마다 크게 다를 수 있습니다. 결과적으로, 유전자 발현의 제어 수준은 또한 유전자 사이에 상당히 극적으로 다를 수 있습니다. 프로모터의 목적은 전사 개시를 제어하는 ​​전사 인자에 결합하는 것입니다.

코어 프로모터 영역 내에서 전사 시작 부위의 상류에 있는 25~35개 염기가 TATA 상자에 있습니다. TATA 상자는 5'-TATAAA-3'의 합의 시퀀스를 가지고 있습니다. TATA 상자는 TATA 결합 단백질을 포함하는 TFIID라는 단백질 복합체의 결합 부위입니다. TFIID의 결합은 TFIIB, TFIIE, TFIIF 및 TFIIH를 포함한 다른 전사 인자를 모집합니다. 이러한 전사 인자 중 일부는 RNA 폴리머라제를 프로모터에 결합하는 데 도움이 되며, 나머지는 전사 개시 복합체를 활성화하는 데 도움이 됩니다.

TATA 상자 외에도 일부 프로모터에는 다른 결합 부위가 있습니다. 일부 생물학자들은 진핵생물 프로모터의 범위를 코어 프로모터 또는 중합효소 결합 부위로 제한하는 것을 선호하며, 이러한 추가 부위를 프로모터-근위 요소로 지칭하는 것을 선호합니다. . 이러한 요소의 예로는 합의 시퀀스가 ​​5'-CCAAT-3'인 CAAT 상자와 합의 시퀀스가 ​​5'-GGGCGG-3'인 GC 상자가 있습니다. 특정 전사 인자는 이러한 프로모터-근위 요소에 결합하여 유전자 전사를 조절할 수 있습니다. 주어진 유전자는 이러한 특정 전사 인자 결합 부위의 고유한 조합을 가질 수 있습니다. 세포에는 수백 개의 전사 인자가 있으며, 각각은 특정 DNA 서열 모티프에 특이적으로 결합합니다. 전사 인자가 암호화된 유전자의 바로 상류에 있는 프로모터에 결합할 때, 유전자 바로 옆의 동일한 염색체에 있기 때문에 시스 작용 요소라고 합니다. 전사 인자는 단백질이 결합 부위를 찾고 필요한 유전자의 전사를 시작하게 하는 환경 자극에 반응합니다.

인핸서 및 전사

일부 진핵생물 유전자에는 전사를 증가시키거나 향상시키는 데 도움이 되는 추가 영역이 있습니다. 인핸서(enhancer)라고 하는 이러한 영역은 그들이 향상시키는 유전자와 반드시 가까운 것은 아닙니다. 그들은 유전자의 상류, 유전자의 코딩 영역 내, 유전자의 하류에 위치하거나 수천 뉴클레오티드 떨어져 있을 수 있습니다.

인핸서 영역은 특정 전사 인자에 대한 결합 서열 또는 부위입니다. 단백질 전사 인자가 인핸서 서열에 결합하면 단백질의 모양이 변하여 프로모터 부위의 단백질과 상호 작용할 수 있습니다. 그러나 인핸서 영역이 프로모터에서 멀리 떨어져 있을 수 있으므로 두 부위의 단백질이 접촉할 수 있도록 DNA가 구부러져야 합니다. DNA 굽힘 단백질은 DNA를 굽히고 인핸서와 프로모터 영역을 함께 가져오는 데 도움이 됩니다((그림)). 이러한 모양 변화는 인핸서에 결합된 특정 활성화제 단백질과 프로모터 영역 및 RNA 폴리머라제에 결합된 일반 전사 인자의 상호작용을 허용합니다.


유전자 끄기: 전사 억제인자

원핵 세포와 마찬가지로 진핵 세포에도 전사를 방지하는 메커니즘이 있습니다. 전사 억제인자는 프로모터 또는 인핸서 영역에 결합하여 전사를 차단할 수 있습니다. 전사 활성화제와 마찬가지로 억제인자는 외부 자극에 반응하여 활성화된 전사 인자의 결합을 방지합니다.

섹션 요약

전사를 시작하려면 TFIID, TFIIB 등과 같은 일반 전사 인자가 먼저 TATA 상자에 결합하고 해당 위치에 RNA 중합효소를 모집해야 합니다. 추가적인 전사 인자는 또한 전사를 증가시키거나 방지하기 위해 프로모터의 다른 조절 요소에 결합할 수 있습니다. 프로모터 서열 외에도 인핸서 영역은 전사를 증가시키는 데 도움이 됩니다. 인핸서는 업스트림, 다운스트림, 유전자 자체 내 또는 다른 염색체에 있을 수 있습니다. 인핸서 영역에 결합된 특정 전사 인자는 전사를 증가시키거나 방지할 수 있습니다.

무료 응답

프로모터 영역 내의 돌연변이는 유전자의 전사를 변경할 수 있습니다. 이것이 어떻게 일어날 수 있는지 설명하십시오.

프로모터 영역의 돌연변이는 일반적으로 전사를 증가시키기 위해 결합하는 전사 인자의 결합 부위를 변경할 수 있습니다. 돌연변이는 결합하는 전사 인자의 능력을 감소시켜 전사를 감소시킬 수 있거나, 또는 결합하는 전사 인자의 능력을 증가시켜 전사를 증가시킬 수 있다.

세포에 활성화 전사 인자가 너무 많으면 어떤 일이 일어날 수 있습니까?

활성화 전사 인자가 너무 많으면 세포에서 전사가 증가합니다. 이것은 세포 기능의 극적인 변화로 이어질 수 있습니다.

한 과학자가 유전자의 300bp 다운스트림에서 잠재적인 전사 조절 부위를 확인하고 그것이 억제인자라고 가정합니다. 그는 이 가설을 뒷받침하기 위해 어떤 실험(결과 포함)을 수행할 수 있습니까?

그의 가설을 테스트하는 가장 쉬운 방법은 세포의 부위를 돌연변이시키고 그 유전자로 만들어진 mRNA 전사체의 수준을 모니터링하는 것입니다. 돌연변이된 세포에서 전사체 수준이 증가하면 해당 부위가 전사를 억제하고 있는 것입니다.

용어 사전


IMGT®, 국제 ImMunoGeneTics 정보 시스템®

제공되는 정보는 각 유전자에 대해 다음을 포함합니다:
1) 서열이 추출된 클론의 공개 등록 번호(또는 NCBI 어셈블리 위치 및 버전), 제안된 유전자 이름(임시), 위치는 해당 등록 번호에서 시작하고 끝납니다.
2) FASTA 형식의 해당 시퀀스:
- V 유전자의 경우: L-PART1(atg)의 시작부터 V-RS의 3'말단까지
- D 유전자의 경우: 5'D-RS의 5' 말단에서 3'D-RS의 3' 말단까지
- J 유전자의 경우: J-RS의 5' 말단에서 J-REGION의 3' 말단까지
- C 유전자의 경우: 첫 번째 엑손의 5' 말단에서 마지막 엑손의 3' 말단(종료 코돈)까지.
3) 제안된 기능(F, ORF, P) 및 설명(유용할 수 있는 설명, 예를 들어 유전자가 'ORF' 또는 'P'로 간주되는 이유)
4) 추가적으로, V 유전자의 경우,
- CDR-IMGT 길이(생식계열 CDR3-IMGT는 존재하는 경우 V-HEPTAMER의 상류에 1개 또는 2개의 뉴클레오티드를 포함함)
- IMGT/V-QUEST에서 제공한 가장 가까운 인간 V-REGION 유전자 및 대립유전자(점수, 동일성 백분율 및 정렬 길이 비율 포함).
유사유전자의 경우 프레임 외 결함 요약과 함께 'V-REGION에서 삽입 및 삭제 검색' 옵션을 사용하여 얻은 위의 정보(예: '1 del(1), 2 in(1,2) ' 1개 뉴클레오티드(nt)의 1개 결실, 1개 nt 및 2nt의 2개 삽입).

IG 및 TR 부분군 번호

IG 및 TR 하위 그룹 번호는 가능할 때마다 할당됩니다. 호모 사피엔스 하위 그룹(V-REGION 뉴클레오타이드 서열 동일성 >75% 기능 및 ORF 유전자 및 정보의 경우 CDR-IMGT 길이). 이것은 일부 호모 사피엔스 일부 종에서는 하위 그룹 번호가 표시되지 않거나 반대로 에 표시되지 않은 하위 그룹에 대해 새 번호가 추가될 수 있습니다. 호모 사피엔스.

  • º IG의 경우 유전자 번호는 하위 그룹에 관계없이 유전자좌의 국소화를 나타냅니다. 유전자 수는 유전자좌의 3'(D 및/또는 J 유전자 옆의 하류)에서 유전자좌(상류)의 5'로 증가합니다.
    전: 호모 사피엔스 아이고. http://www.imgt.org/IMGTrepertoire/index.php?section=LocusGenes&repertoire=locus&species=human&group=IGH
  • º TR의 경우, 유전자 번호는 주어진 하위 그룹에 속하는 유전자의 유전자좌에서의 각각의 위치를 ​​나타냅니다. 유전자 수는 유전자좌(상류)의 5'에서 유전자좌(하류, D 및/또는 J 유전자 옆)의 3'으로 주어진 하위 그룹에 대해 증가합니다.
    전: 호모 사피엔스 TRB. http://www.imgt.org/IMGTrepertoire/index.php?section=LocusGenes&repertoire=locus&species=human&group=TRB

르프랑 M-P. 면역글로불린(IG) 및 T 세포 수용체 유전자(TR): IMGT® 및 면역정보학의 탄생과 부상. 프론트 이뮤놀. 2014년 2월 055:22. doi: 10.3389/fimmu.2014.00022. 오픈 액세스. PMID:24600447 "partial in 3'" 또는 "partial in 5'"는 서열을 비기능적으로 만들거나 유전자 영역이 완전히 서열화되지 않았기 때문입니까? "partial in 3' " 또는 "partial in 5' "는 유전자 영역이 완전히 시퀀싱되지 않았음을 나타냅니다. "F"로 표시되지만 정지 코돈으로 끝나는 몇 가지 서열이 있습니다. 이것들이 기능적입니까? V-(D)-J 재배열 동안 stop codon이 잘리고 N-영역으로 대체될 가능성이 높을 때 유전자는 기능적인 것으로 간주됩니다. 일부 호모 사피엔스 TRBV 유전자에서 'OR9'는 무엇을 의미합니까? IMGT 유전자 이름의 'OR9'는 이 유전자가 9번 염색체에 위치한 orphon 'OR'임을 나타냅니다.
오르폰은 주 유전자좌 외부의 염색체 위치에서 확인된 유전자이므로 생체 내 IG 또는 TR 사슬 합성에 참여할 수 없습니다.
http://www.imgt.org/IMGTindex/orphon.php
http://www.imgt.org/IMGTScientificChart/Nomenclature/IMGTnomenclature.html
IMGT/V-QUEST에서 orphons는 'F+ORF+ in-frame P'에서 제외되지만(예: 레퍼토리 분석에 사용됨) 관련성이 있는 경우(예: 게놈 분석) '포함하는 orphons' 옵션을 사용하여 검색할 수 있습니다. ' 고급 매개변수에서. 리더 서열에 정지 코돈이 있으면 어떻게 됩니까? 리더 서열의 정지 코돈은 유전자 또는 대립 유전자를 가유전자. 의 경우입니다 호모 사피엔스 IGKV1-39*02 대립유전자는 Gene table에서 'P'(pseudogene)로 표기 호모 사피엔스 IGKV: http://www.imgt.org/IMGTrepertoire/index.php?section=LocusGenes&repertoire=genetable&species=human&group=IGKV 이러한 대립 유전자 또는 유전자는 필사 (따라서 5'RACE/NGS 시퀀싱에서 발견됨) 생체 내에서 번역되지 않습니다. 인트론 없이 IG 및/또는 TR 유전자의 뉴클레오티드 서열을 검색하는 방법은 무엇입니까? 인트론이 없는 IG 및/또는 TR 유전자의 뉴클레오티드 서열은 다음 페이지의 '인공적으로 접합된 세트'에서 검색할 수 있습니다. http://www.imgt.org/vquest/refseqh.html#VQUEST EX4는 TRAC 및 TRDC 대립유전자 할당 시 고려됩니까? TRAC 및 TRDC 대립유전자의 할당[1]에서 번역되지 않은 EX4 + 3'UTR(그림 7 페이지 34-35[2])(IMGT 라벨 EX4UTR)의 뉴클레오티드 서열 차이는 TRAC 할당에 고려되지 않습니다. 및 TRDC 대립유전자.
주어진 TRAC 대립유전자 또는 TRDC 대립유전자(예: 호모 사피엔스 따라서 다른 소스의 TRAC*01)은 EX4UTR에서 작은 차이를 표시할 수 있습니다.
추가 정보:
[1] 르프랑 M-P. 면역글로불린(IG) 및 T 세포 수용체 유전자(TR): IMGT® 및 면역정보학의 탄생과 부상. 프론트 이뮤놀. 2014년 2월 055:22. doi: 10.3389/fimmu.2014.00022. 오픈 액세스. PMID: 24600447.
[2] 르프랑, M.-P. 및 Lefranc, G., T 세포 수용체 FactsBook, Academic Press, 398페이지(2001) ISBN:0124413528. 맨 위

© Copyright 1995-2021 IMGT®, 국제 ImMunoGeneTics 정보 시스템® | 이용약관 | 회사 소개 | 저희에게 연락하십시오 | IMGT 인용


전염병의 병인

실험실 진단

폴리 메라 제 연쇠 반응

엔테로바이러스 게놈의 5' 비암호화 영역에서 보존된 서열을 식별하는 프라이머를 사용하는 PCR은 CSF, 호흡기 분비물 및 소변에서 엔테로바이러스 식별을 위한 배양보다 더 민감합니다. 14,152,153 PCR은 심근염 환자의 심장 조직에서 엔테로바이러스 RNA를 검출하는 데에도 사용되었지만66 이들 환자에서 기술의 상대적 민감도와 특이성은 정의되지 않았습니다. 대변 ​​표본의 PCR 테스트는 중합 단계를 억제하는 물질의 존재 때문에 덜 성공적이었습니다.

바이러스 격리

세포 배양에서 바이러스의 분리는 여전히 중요한 실험실 진단 방법입니다. 분리의 성공은 엔테로바이러스 클래스와 클래스 내의 혈청형 간에 크게 다릅니다. 일반적으로 대부분의 엔테로바이러스 분리를 ​​지원하려면 3개 또는 4개의 영장류 세포주가 사용되어야 합니다. 세포변성 효과는 일반적으로 세포 단층 접종 후 2일에서 5일 사이에 분명합니다. 일단 분리되면, Lim Benyesh-Melnick 교차 말 항혈청 풀을 사용하거나 RNA 시퀀싱을 사용하여 대부분의 일반적인 엔테로바이러스에 대해 바이러스 혈청형을 식별할 수 있습니다. 그룹 A coxsackieviruses의 분리를 위한 최적의 방법은 신생아 마우스 접종입니다.

병인학적 진단은 뇌척수액, 심낭액, 조직 또는 혈액에서 바이러스의 분리로 확인됩니다. 세포 배양에서 바이러스를 복구할 수 있는 기회는 여러 사이트를 샘플링하여 최적화됩니다. 관련 없는 병발적인 무증상 감염이 발생할 수 있기 때문에 대변에서 바이러스를 분리하는 것은 확실하지 않습니다. 그러나 위장관에서 배출되는 배경 비율이 낮기 때문에 모든 부위에서 엔테로바이러스의 분리는 인과 관계의 강력한 추정 증거입니다.

혈청학

미세중화 검사는 엔테로바이러스 항체를 결정하는 데 가장 널리 사용되는 방법입니다. 이 혈청형 특이적 분석은 모든 관련 살아있는 바이러스 항원을 분석에 통합하는 것이 가능하지 않고 중화에 기반한 방법이 상대적으로 둔감하고, 제대로 표준화되지 않고, 노동 집약적이기 때문에 비소아마비 엔테로바이러스 감염의 일상적인 진단에서 유용성이 제한적입니다. 유형별 면역분석법은 현재 보다 일반적인 엔테로바이러스 혈청형에 대한 항체를 측정하기 위해 상업적으로 이용 가능하지만 종종 표준화되지 않은 경우가 많습니다. 혈청 IgM 항체는 그룹 B coxsackieviruses, echovirus 30 및 enterovirus 70 감염 과정에서 초기에 검출되었습니다. 그러나 enteroviral IgM assays는 혈청형 특이적 154,155이 아니며 감도가 부족한 것으로 보입니다. 156


재료 및 방법

RT-PCR 및 플라스미드 구성.

RT-PCR의 경우 주입된 세포에서 총 RNA를 추출하고 제조업체의 프로토콜에 따라 M-MLV 역전사효소(Invitrogen) 및 HiFi Taq 중합효소(Invitrogen)를 사용하여 분석했습니다. PCR 반응은 유전자 특이적 프라이머 쌍인 Ftz-127F 및 Ftz-444R(그림 1A 참조)을 사용하여 수행되었으며 대조군에는 마우스 18S rRNA-448F 및 마우스 18S rRNA-926R을 사용했습니다.

ftz 구조는 t-ftz-i(그림 1A 및 그림 S1), t-ftz-Δi 및 그 파생물(그림 S3)을 생성하도록 수정되었습니다. 생체내 포유동물 발현 실험을 위해, t-ftz 구축물을 HindIII 및 XhoI로 분해한 다음 pcDNA3 발현 벡터에 결찰시켰다. 인간 인슐린 cDNA는 cDNA 라이브러리에서 증폭되었고 인슐린 유전자는 HindIII 및 XhoI로 절단된 유전자 특이적 프라이머 쌍을 사용하여 HeLa 게놈 DNA에서 증폭된 다음 pcDNA3 발현 벡터에 연결되었습니다. 인슐린은 5A-인슐린을 생성하기 위해 PCR 프라이머로 변형되었습니다(그림 S3 참조).

RNA 합성, 정제 및 시험관내 번역.

시험관내 전사는 과잉 캡(Ambion)을 포함하는 T7 mMESSAGE mMACHINE 전사 키트를 사용하여 수행되었습니다. cap 유사체로 mRNA를 합성하기 위해 35mM ApppG 또는 3mGpppG(New England Biolabs) 10mM ATP, UTP, CTP 및 1mM GTP로 반응을 수행하였다. 전사체는 폴리(A) 테일링 키트(Ambion)를 사용하여 폴리아데닐화되어 200-300개 뉴클레오티드의 폴리(A) 테일을 생성했습니다. MEGAclear 키트(Ambion)를 사용하여 mRNA 정제를 수행했습니다. 그런 다음 mRNA를 150mM 아세트산칼륨(pH 5.5) 및 2.5부피 100% 에탄올로 침전시켰다. mRNA를 주사 완충액(100mM KCl, 10mM HEPES, pH 7.4)에 재현탁시켰다. mRNA는 35 S-메티오닌(Promega)이 있는 TnT 망상적혈구 용해물 시스템에서 번역되었습니다.

세포 배양, siRNA 및 DNA 형질감염, 미세주입.

NIH 3T3 섬유아세포는 10% 송아지 혈청이 보충된 DMEM에서 유지되었습니다. HeLa 및 COS-7 세포를 10% 소태아혈청이 보충된 DMEM에서 유지하였다. 세포를 유리 커버슬립 바닥(MatTek Corp.)이 있는 35mm 직경 접시에 밤새 플레이팅했습니다. For RNAi experiments, HeLa cells were transfected with siRNA directed against human UAP56 and URH49 [45] or eIF4AIII [59]. 24 and 48 h post transfection, cells were either plated on 35-mm dishes (for microinjections) or collected to assess protein levels by SDS-PAGE and Western blot with rabbit anti-UAP56 serum [4], rabbit anti-eIF4AIII [59], or rabbit anti-CBP80 serum [3]. For DNA transfections, cells were transfected with DNA and lipofectamine (Invitrogen) using the manufacture's protocol.

Microinjections were performed as previously described [60]. mRNA was microinjected at 200 μg/ml along with fluorescein isothiocyanate (FITC)–conjugated 70-kDa dextran (1 mg/ml Invitrogen). Insulin mRNA was heated to 70 °C for 10 min prior to injections. DNA was injected at 50 μg/ml along with FITC-conjugated 70-kDa dextran, and translation was inhibited with 50 μg/ml α-amanitin (Sigma). For export inhibition experiments, cells were first microinjected with WGA (3 mg/ml Sigma) or CTE RNA (200 μg/ml) along with cascade-blue–conjugated 10-kDa dextran (Invitrogen), and then incubated for 30 min at 37 °C prior to mRNA microinjection. For azide treatments, microinjected cells were washed three times with Dulbecco's modified PBS (D-PBS 10 mM phosphate, pH 7.4, 140 mM NaCl, 3 mM KCl, 0.8 mM CaCl2, 0.7 mM MgCl2) and incubated in D-PBS supplemented with 10 mM azide (Sigma) or 10 mM D-glucose (Sigma). For pactamycin treatments, cells were incubated in DMEM (10% fetal bovine serum) with 200 nM pactamycin 20 min before microinjections.

Immunostaining and FISH.

Microinjected cells were washed with D-PBS, fixed in 4% paraformaldehyde (Electron Microscope Sciences) in D-PBS, and permeabilized with 0.1% Triton X100 (Peirce) in PBS. For immunostaining, fixed samples were first incubated with primary antibodies (rabbit polyclonal against TRAPα [61], goat polyclonal antibody against TIA-1 [Santa Cruz Biotechnology], 12CA5 monoclonal antibody against HA [Roche Applied Sciences], and M2 monoclonal antibody against FLAG [Sigma]) diluted 1:200 in immunostain solution (PBS, 0.1% Triton X100, 2 mg/ml RNAse free BSA Ambion) for 30 min, washed three times with PBS, and incubated with various Alexa-conjugated secondary antibodies (Invitrogen), diluted 1:200 in immunostain solution. For FISH, fixed cells were washed with 50% formamide in 1X SSC (150 mM NaCl, 15 mM NaCitrate, pH 7.10) and then incubated overnight at 37 °C in 200-ml hybridization buffer (50% formamide, 100 mg/ml dextran sulphate, 0.02 mg/ml RNAse free BSA, 1 mg/ml Escherichia coli tRNA, 5 mM VRC, 1X SSC) containing 30–50 ng oligonucleotide probe (GTCGAGCCTGCCTTTGTCATCGTCGTCCTTGTAGTCACAACAGCCGGGACAACACCCCAT for ftz, GGTCCTCTGCCTCCCGGCGGGTCTTGGGTGTGTAGAAGAAGCCTCGTTCCCCGCACACTA for insulin) labeled at their 5′ end with Alexa-546 (Integrated DNA Technologies). Cells were washed in five times with 50% formamide in 1X SSC and images were captured using an EM-CCD Camera, Model C9100–12 (Hamamatsu) on an inverted microscope (200M, Carl Zeiss) using Metamorph software (Molecular Devices Corporation). Unaltered 14-bit images were quantified in Metamorph and analyzed in Excel (Microsoft). For each image the area (NS) and the average intensity (NS) of each injected nuclei (N) and cell body (NS) were recorded. For the background intensity, the average intensity of an un-injected cell ()를 사용하였다. The cytoplasmic fluorescence was equal to (Ab)(Iu) – (NS)(Iu). The ratio of cytoplasmic/total fluorescence equals [(Ab)(Iu) – (NS)(Iu)]/[(Ab)(Iu)]. For figure production, the contrast and brightness of the aquired 14-bit micrographs were adjusted to optimize the ability to view the fluorescence. The resulting images were converted to 8-bit files using Metamorph.



코멘트:

  1. Deven

    확실히 그가 옳다

  2. Wematin

    It agree, the helpful information

  3. Voodoorisar

    모르겠어요

  4. Fer

    놀랍다, 웃긴 부분이다.

  5. Frewyn

    멋지다 재미있는 의견이다

  6. Jocelina

    슬퍼



메시지 쓰기