정보

특정 효모 유전자를 자동화된 방식으로 다운로드하시겠습니까?

특정 효모 유전자를 자동화된 방식으로 다운로드하시겠습니까?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

나는 6개의 유전자를 가지고 있다. 칸디다 알비칸스 효모 즉orf19.723,orf19.5908,orf19.610,orf19.2119,orf19.4998그리고orf19.4056. 그리고 다른 16종의 효모에 대한 Broad Institute 웹사이트에서 상응하는 ortholog 유전자를 찾았습니다. 그래서 나는 모든 유전자 이름을 가지고 있습니다. 이제 이 유전자를 어떻게 구체적으로 다운로드하고 어디에서 자동화된 방식으로 이 작업을 수행할 수 있습니까?

또한 표준 명명 규칙이 있습니까? 주어진 ORF 이름에는 BCR1, EFG1 및 NDT80과 같은 다른 이름도 있기 때문입니다.

내가 가지고 있는 유전자 이름 목록:

S. cerevisiae의 orf19.2119 YHR124W orf19.4998 YBR033W YKL034W orf19.5908 YBR083W orf19.610 YMR016C YKL043W orf19.723 NONE orf19.4056 YMR136W와 orthologs S. paradoxus orf19.2119 spar33와 C. 알비 칸스의 C. 알비 칸스의 orthologs -g1.1 orf19.4998 spar197-g23.1 spar324-g3.1 orf19.5908 spar200-g4.1 orf19.610 spar184-g1.1 spar324-g10.1 orf19.729 spar0.1 orf19.723 N S. mikatae orf19.2119 NONE orf19.4998 smik146-g12.1 smik109-g17.1 orf19.5908 orf19.5908 smik83-g2.1 orf19.671s-smik.15 723 없음 orf19.4056 smik1535-g1.1 C. Albicans와 S. bayanus orf19.2119 sbayc514-g9.1 orf19.4998 orf19.4998 sbayc611-g22.1 sbayc.519 orfbayg90c.519-9 S.610 sbayc638-g23.1 sbayc652-g27.1 orf19.723 없음 orf19.4056 sbayc657-g41.1 C. Albicans와 S. castellii orf19.2194 orf19.2197.08 orf19.2197.2 .27 Scas635.12 orf19.610 Scas106.1 Scas709.52 Scas625.8 orf19.723 없음 orf19.4056 Scas680.22 D C. 글라 브라 orf19.2119 CAGL0L13090g orf19.4998 CAGL0L01947g orf19.5908 CAGL0M01716g CAGL0F04081g orf19.610 CAGL0M07634g CAGL0L01771g orf19.723 NONE orf19.4056 S. kluyveri의 orf19와 C. 알비 칸스의 orthologs CAGL0I00902g CAGL0L06776g와 C. 알비 칸스의 orthologs. K.와 C. 알비 칸스의 2,119 SAKL0E11330g orf19.4998 SAKL0A09812g orf19.5908 SAKL0B06578g orf19.610 SAKL0D13442g orf19.723 SAKL0A03476g orf19.4056 SAKL0E04862g orthologs는 orf19.2119 KLLA0F24420g orf19.4998 KLLA0F25674g orf19.5908 KLLA0E12507g orf19.610 KLLA0F04840g orf19 락 티스. 723 없음 orf19.4056 KLLA0F17116g의 K. waltii와 A. gossypii orf19.2119 AGR347W orf19.4998 AFR275W orf19.5908 AER177W orf19.610 ABR055C orf19.723 NONE orf19.4056 ADR249W와 orthologs C. 알비 칸스의 C. 알비 칸스의 orthologs orf19.2119 Kwal33.14699 orf19.4998 Kwal26.8099 orf19.5908 Kwal27.12423 orf19.610 Kwal26.8176 orf19.723 NONE orf1 orf19.723 NONE orf19.4056 Kwal49. orf19.4998 CTRG03636.3 orf19.5908 CTRG02294.3 orf19.610 NONE orf19.723 CTRG00608.3 orf19.4056 CTRG04523.3 L.9 orf1 orf1 orf10.9 L. elongosporus219.610 LELG05390 orf19.723 LELG03123 orf19.4056 LELG01761 C.의 파라 프 실로 시스와 C. albicans에의 orthologs orf19.2119 CPAG04608 orf19.4998 NONE orf19.5908 CPAG01691 orf19.610 CPAG00178 orf19.723 CPAG00564 orf19.4056 CPAG05034 C. albicans에의 orthologs와 D. hansenii orf19.2119 DEHA2A07282g orf19.4998 없음 orf19.5908 DEHA2G13794g orf19.610 DEHA2E10978g orf19.723 DEHA2E05984g orf19.4056 DEHA2E07172g DEHA2F25916g C. 귤 리에 몬디 orf19.2119 PGUG02096.1 orf19.4998 없음 orf19와 C. albicans에의 orthologs. 5908 PGUG04378.1 orf19.610 PGUG03651.1 orf19.723 PGUG05571.1 orf19.4056 PGUG05533.1 C. lusitaniae orf19.2119 CLUG00404 orf19.4998 NONE orf19.5908 CLUG04694 orf19.610 CLUG02047 orf19와 C. 알비 칸스의 orthologs. 723 CLUG00627 orf19.4056 CLUG05535

이러한 시퀀스에는 표준 ID가 없습니다. Saccharomyces Genome Database의 정보도 더 이상 사용되지 않으며(2005) 이러한 식별자가 없습니다.

이러한 시퀀스는 여기(같은 사이트)에서 찾을 수 있습니다.

각 종에는 짧은 이름이 있습니다.

유기체 짧은 이름 S.cerevesiae Scer S. bayanus Sbay S. paradoxus Spar A. gossypii Agos… 등등.

속명의 첫 글자는 대문자 + 종명의 첫 3글자는 소문자.

fasta 파일(모든 ORF용)은 다음과 같습니다.
www.broadinstitute.org/regev/orthogroups/nt/.파스타

거기에서 grep을 사용하여 시퀀스를 검색할 수 있습니다.

따라서 짧은 이름과 유전자 이름을 두 개의 개별 파일로 저장했다면 다음과 같이 할 수 있습니다.

'cat shortname.txt'의 짧은 이름의 경우; do wget -O tmp.fa "http://www.broadinstitute.org/regev/orthogroups/nt/"$shortname.fasta; grep -A 1 -f ids.txt tmp.fa >> $shortname"_Select.fa"; 완료

좋습니다. 첫 번째 단계는 이러한 모든 ID를 동일한 데이터베이스에 매핑하는 것입니다. 다른 단백질 서열을 원하면 http://uniprot.org를 사용해 보십시오. 각각을 찾아 해당 Refseq ID를 찾으십시오. 여러 데이터베이스의 ID가 있으므로 개별적으로 Google에 검색해야 할 수도 있습니다. 보유하고 있는 각 식별자의 ID 유형을 알고 있다면 DAVID의 ​​유전자 이름 변환기와 같은 도구를 사용하여 자동화할 수 있습니다.

동일한 데이터베이스의 ID 목록이 있으면 파일에 저장합니다(한 줄에 하나의 ID). 그런 다음 UniProt 액세스의 경우 다음을 실행하여 FASTA 단백질 서열을 얻을 수 있습니다.

이름을 읽는 동안; wget -O - http://uniprot.org/$name.fasta; 완료 < name.txt

RefSeq ID의 경우 Entrez의 일괄 검색 도구를 사용할 수 있습니다.


합성 효모 염색체 팔 압축

중복성은 아마도 다양하고 변화하는 조건에서 강력한 성장을 보장하기 위한 게놈의 일반적인 특징입니다. 주어진 조건에 필요하지 않은 시퀀스를 제거하는 게놈 압축은 생명의 핵심 원리를 이해하는 새로운 방법을 제공합니다. loxP 매개 진화(SCRaMbLE) 시스템에 의한 합성 염색체 재배열 및 수정 시스템은 합성 효모 게놈(Sc2.0)에 이식된 고유한 기능으로, 게놈 최소화를 위한 효과적인 도구로 제안됩니다. Sc2.0 프로젝트가 거의 완료됨에 따라 우리는 게놈 압축에 SCRaMbLE 시스템의 적용을 탐구하기 시작했습니다.

결과

우리는 SCRaMbLE 기반 게놈 압축(SGC)이라는 방법을 개발하고 합성 염색체 팔(synXIIL)이 효율적으로 감소될 수 있음을 보여줍니다. 사전 도입된 에피솜 필수 유전자 어레이는 loxPsym 단위를 포함하는 필수 유전자에 있는 비필수 유전자의 삭제를 가능하게 할 뿐만 아니라 단일 SGC 프로세스에서 더 많은 염색체 서열을 제거할 수 있게 함으로써 SGC의 압축 능력을 크게 향상시킵니다. 추가 압축은 반복적인 SGC를 통해 이루어지며, synXIIL의 65개 비필수 유전자 중 적어도 39개가 풍부한 배지에서 30°C에서 세포 생존에 영향을 미치지 않고 집합적으로 제거될 수 있음을 보여줍니다. 28개의 유전자를 암호화하는 합성 서열의 약 40%는 풍부한 배지에서 30°C에서 세포 성장에 필수적인 것으로 밝혀졌으며 특정 조건에서 기능이 필요한 여러 유전자가 확인되었습니다.

결론

우리는 합성 효모 게놈을 압축하기 위한 일반적이면서도 효과적인 도구인 eArray의 도움으로 반복적인 SGC를 개발합니다.


추상적 인

우리는 고도로 변형된 합성 진핵생물 게놈 Sc2.0의 완전한 디자인을 설명합니다. 사카로마이세스 세레비지애 게놈의 크기가 거의 8% 감소했으며 합성 게놈의 1.1 메가베이스가 삭제, 삽입 또는 변경되었습니다. Sc2.0 염색체 디자인은 뉴클레오티드에서 게놈 규모까지 디자인 수정을 조정하고 편집을 체계적으로 추적하기 위해 버전 제어를 시행하는 진핵생물 게놈 디자인을 위해 개발된 오픈 소스 프레임워크인 BioStudio로 구현되었습니다. 완전한 Sc2.0 게놈 합성을 달성하기 위해 전 세계 Sc2.0 컨소시엄 팀이 구축한 개별 합성 염색체는 "내복제 상호교배"를 통해 단일 균주로 통합됩니다. Sc2.0과 같은 화학적으로 합성된 게놈은 완전히 맞춤화할 수 있으며 실험가는 상향식 설계 전략을 사용하여 염색체 구조, 기능 및 진화에 대해 다루기 힘든 질문을 할 수 있습니다.

Sc2.0 프로젝트의 목표는 진핵생물 염색체에 대한 체계적인 연구를 위한 플랫폼 역할을 하는 진핵생물 모델 유기체에 대한 맞춤 설계된 게놈의 완전한 합성입니다. 염색체를 구축하려는 전 세계적인 Sc2.0 노력은 여러 지역에 분산되어 있습니다. Sc2.0의 이러한 독특한 측면은 공통 조립 전략을 가능하게 하고 중간 설계된 염색체와 살아있는 균주를 모두 설명하기 위해 공유 언어를 적용하는 BioStudio 소프트웨어 측면의 설계에 동기를 부여했습니다.

Sc2.0 게놈 서열의 출발점은 고도로 큐레이트된 사카로마이세스 세레비지애 순서 (1, 2). Sc2.0 게놈 설계를 안내하는 원칙은 유도 가능한 유전적 유연성을 도입하고 천연 효모 DNA의 반복적인 특성으로 인한 게놈 불안정성의 원인을 최소화하면서 "야생형" 표현형을 유지하려는 욕구의 균형을 유지합니다. 따라서 Sc2.0 염색체는 모든 TAG 정지 코돈이 TAA로 변경되는 약간 변형된 유전 코드를 암호화하도록 설계되었습니다.3) 유도성 진화 시스템 SCRaMbLE를 뒷받침하는 loxPsym 사이트를 포함합니다(4, 5) 및 반복 요소가 부족하기 위해 RNA(tRNA) 유전자("신염색체"로 재배치됨) 및 많은 인트론이 필요합니다. 또한 PCRTags라고 하는 오픈 리딩 프레임(ORF) 내의 짧은 기록 시퀀스는 합성 DNA와 야생형을 구별하기 위한 중합효소 연쇄 반응(PCR) 기반 분석을 용이하게 합니다.57). 마지막으로, ORF 내의 염기 치환은 합성 염색체의 조립을 촉진하기 위해 효소 인식 부위를 도입하거나 제거합니다.

전체 게놈 규모에서 Sc2.0 재설계를 구현하려면 200kb~>1Mb 크기의 합성 염색체에 대한 일반 DNA 조립 파이프라인뿐만 아니라 유연한 계산 도구도 구축해야 했습니다. 이제 Sc2.0 게놈 설계를 완료했으며 여기에서 노력을 설명합니다. 현재까지 6.5개의 Sc2.0 디자이너 염색체가 별개의 균주로 구성되었습니다(5, 813), 여기에서는 2.5개의 합성 염색체를 단일 균주로 통합하는 것을 보여줍니다. 합성 균주의 야생형 표현형은 설계자 기능의 광범위한 허용 오차와 일치하며 전반적인 견고성을 나타냅니다. S. 세레비지애 유전자 조작에.


돌연변이 대립유전자 구축

인간화 효모는 특히 체계적이고 처리량이 많은 접근 방식에 적합한 인간 유전자 기능을 분석하기 위한 단순화된 컨텍스트를 제공합니다. 인간화된 시스템을 이용하기 위해서는 인간 유전자의 흥미로운 대립유전자의 원천이 필요하다. 초기 접근 방식은 인간 질병과 관련된 알려진 대립 유전자에 초점을 맞추었지만 최근에는 "중요하지 않은 변이체"와 가능한 모든 아미노산 치환을 포함하도록 확장되었습니다. Fowler와 Fields(14)가 개척한 심층 돌연변이 스캐닝 기술은 가능한 가장 높은 밀도에서 단일 아미노산 치환 대립유전자의 생성을 허용합니다. 표현형 분석에 연결될 때 심층 돌연변이 스캔은 원하는 특성, 일반적으로 일종의 기능 손실을 가진 돌연변이 대립유전자를 나타냅니다. Hamzaet al. (5) 화면 펜1 촉매 작용을 비활성화하지만 DNA 결합은 비활성화하도록 설계된 대립형질은 FEN1-DNA 복합체의 포획을 초래할 가능성이 있습니다. 심층 돌연변이 스캐닝은 촉매 활성을 잃지만 단백질-DNA 또는 단백질-단백질 상호작용(15)을 유지하는 기능 돌연변이를 분리하는 데 사용할 수 있으며, 이는 Hamza et al. 그들의 모델 펜1 대립 유전자.


효모 시스템 생물학: 세포 모델링을 위한 최선의 방법

미국 유전 학회(The Genetics Society of America)의 에드워드 노비츠키 상(Edward Novitski Prize)은 유전 연구의 중대한 문제를 해결하는 데 있어 탁월한 수준의 창의성과 지적 독창성을 인정합니다. 2014년 수상자인 Charles Boone은 유전 상호작용 네트워크의 글로벌 매핑에 중점을 두어 포스트게놈 시스템 생물학의 새로운 학문 분야의 정상으로 떠올랐습니다. Boone은 정확한 돌연변이를 가진 수천 개의 균주를 교차시키고 대규모 효모 유전적 상호작용을 매핑하는 자동화된 방법을 제공하는 합성 유전 배열(SGA) 기술을 발명했습니다. 이 네트워크 지도는 연구자에게 유전자를 특정 경로로 묶고 기능적 연결을 나타내는 세포의 기능적 배선 다이어그램을 제공합니다.

효모는 다른 어떤 세포보다 더 잘 이해되고 있다고 말하는 것이 안전합니다. 전 세계 수백 개의 실험실에서 수십 년 동안 다양한 관점에서 이 강력한 유전 모델을 연구해 왔으며 우리는 대부분의 경로와 세포 기능을 이해하는 데 눈부신 발전을 이루었습니다. 그럼에도 불구하고 우리 중 누구도 효모 세포가 실제로 어떻게 작동하는지 알고 있다고 주장하지 않을 것입니다.

가장 큰 문제는 계속 증가하는 상세한 생물학적 정보가 아직 완전하고 통합된 그림으로 조합되지 않았다는 것입니다. 궁극적으로 전체 세포 수준에서 생명을 모델링하려면 모든 구성 요소가 어떻게 연결되고 조정되는지 이해해야 합니다. 그래야만 특정 유전적 또는 환경적 섭동에 대한 생리학적 반응을 예측할 수 있습니다. 벅찬 작업이지만 세포 모델링은 우리가 충분히 이해할 수 있는 일이며 편견이 있을 수 있지만 신진 효모가 이 과제를 실현하는 데 가장 좋은 기회라고 생각합니다.

세포에 대한 포괄적인 이해를 위한 획기적인 첫 번째 단계는 진핵생물( Goffeau et al. 1996). 효모 게놈에 대한 완전한 그림을 갖게 되면서 이전에는 거의 상상할 수 없었던 기능적 게놈 접근 방식이 가능해졌습니다. 오레곤 대학의 박사후 과정 연구원으로서 당시에는 완전히 엉뚱한 생각처럼 보였던 것에 충격을 받은 기억이 있습니다. 저녁 식사 시간에 방문 연사인 Stan Fields는 2-하이브리드 분석( Uetz et al. 2000). 동시에 학문적(Derisi 1997 Eisen et al. 1998) 및 상업 기업( Dimster-Denk et al. 1999 휴즈 et al. 2000), 전체 전사 반응을 밝히기 위해 게놈 차원의 유전자 발현 분석을 개척했습니다. 한편, 체계적인 표현형 스크린은 트랜스포존 돌연변이 유발 라이브러리의 형태로 조립된 게놈 규모의 돌연변이 컬렉션에 의해 가능했습니다(Ross-Macdonald et al. 1999) 및 삭제 컬렉션( Winzeler et al. 1999 기아에버 et al. 2002). 종합하면, 이러한 시스템 수준의 접근 방식은 과학에 대한 새로운 통합 사고 방식을 제공했으며, 이는 합성 유전 배열(SGA) 분석이라고 하는 자동화된 형태의 효모 유전학에 영감을 주었습니다( Tong et al. 2001), 게놈 차원에서 유전적 상호작용을 매핑하도록 설계된 방법론( Tong et al. 2004).

통합된 방식으로 전체 효모 연구 커뮤니티의 전문성과 힘을 활용하는 것은 정교한 CERN과 유사한 과학의 궁극적인 시스템 수준 접근 생물학 버전을 나타냅니다.

—C.B.

기능 유전체학의 성공은 대규모 실험 전략을 설계, 구현 및 해석할 수 있는 다학문 팀에 달려 있습니다. 이 프로세스의 필수적인 부분은 새로운 데이터를 처리하고 정량화하는 데 필요한 계산 분석입니다. 시약과 아이디어를 공개적으로 공유하는 효모 커뮤니티의 문화가 우리 모두가 이 새로운 스타일의 광범위하게 협력하는 과학을 수용할 수 있도록 준비했다고 생각합니다. 의 발전 사카로마이세스 Genome Database(SGD)(Cherry 1998) 또한 집중 연구와 대규모 연구 모두에서 데이터를 수집하고 구성함으로써 이러한 개방형 액세스 문화를 구축하는 데 중요한 역할을 했습니다. SGD는 전문가 팀을 통해 주로 집중 연구에서 파생된 데이터를 선별하여 효모 유전자에 대한 기계 판독 가능 유전자 온톨로지(GO) 주석을 생성합니다( Ashburner et al. 2000). 이 상세한 주석은 유전자 기능에 대한 이해를 전달하는 데 중요하지만 품질과 폭이 다를 수 있는 대규모 연구에서 파생된 기능 정보를 정량화하기 위한 황금 표준도 제공합니다. 따라서 SGD는 이전에 특성화되지 않은 유전자의 역할을 해결하고 겉보기에는 관련이 없어 보이는 프로세스 간의 새로운 기능적 연결을 매핑할 수 있는 광범위한 잠재력을 통해 매우 정확하지만 편향된 집중 연구와 글로벌 연구 사이의 격차를 해소합니다.

정확히 모든 효모 실험 데이터를 조정하고 일반적으로 사용할 수 있도록 하기 때문에 SGD는 우리 분야의 중심이 되었습니다. 아마도 가장 중요한 것은 SGD를 통해 효모 커뮤니티가 게놈의 기능적 주석을 처리하기 위한 매우 성공적인 모델을 매핑했다는 것입니다. 사실, 내가 주요 자금 출처를 지시한다면 인간 게놈에 대한 유사한 SGD 전략의 구현에 막대한 투자를 할 것입니다(즉., HGD). SGD 웹사이트가 시작된 이후 거의 매일 방문했기 때문에 HGD 웹사이트가 인간 유전과 인간 게놈에 대한 이해에 헤아릴 수 없는 영향을 미칠 것이라고 상상할 수 있습니다.

최근 금융 위기의 여파로 우리 정부는 기초 과학 자금 지원을 줄이고 있으며 불행히도 HGD와 같은 프로젝트에 대한 지원은 거의 불가능합니다. 아이러니하게도 생명이 어떻게 작동하는지에 대한 기계론적 이해가 본격적으로 시작되는 시점에 기초 연구에 투입되는 자원은 줄어들고 있습니다. 이를 염두에 두고 HGD가 개인정보회사의 포트폴리오에 딱 들어맞을 것은 자명해 보인다. HGD를 조립하는 것은 궁극적으로 정밀 의학의 기반이 되기 때문에 수익성이 있을 수밖에 없습니다. 과거에 우리 모두는 인간 게놈의 서열을 소유한 기업의 이익에 대해 걱정했고, 아이러니하게도 오늘날의 환경에서 민간 부문이 HGD와 같은 프로젝트에 자금을 지원하는 유일한 희망일 수 있습니다.

SGA 유전자 네트워크 분석은 우리 연구 그룹에 SGD, BioGRID( Stark et al. 2006), 효모 게놈의 기능적 주석에 기여하는 기타 데이터베이스. Brenda Andrews, Michael Costanzo 및 저는 효모에 대한 완전한 유전적 상호작용 네트워크를 매핑하는 데 필요한 방법론과 시약을 조립하고 구현하기 위해 함께 작업했습니다. 우리의 주요 전산 협력자인 Chad Myers와 그의 팀은 대규모이지만 상대적으로 시끄러운 데이터 세트에서 의미 있는 정보를 추출하는 방법을 알아내는 데 주로 책임이 있습니다. SGA 분석을 통해 우리는 이중 돌연변이가 각각 예상보다 나빠지거나 좋아지는 것으로 점수가 매겨지는 음성 및 양성 유전 상호 작용을 모두 정량화합니다( Baryshnikova et al. 2010). 수십만 개의 유전적 상호작용으로 구성된 글로벌 유전 네트워크의 어셈블리는 경로를 식별하고 필수 세포 기능을 제어하기 위해 함께 작동하는 방식을 설명하며 세포의 기능적 배선 다이어그램을 매핑하는 조합 유전학의 힘을 강조합니다( Costanzo et al. 2010).

10여 년 전 Lee Hartwell과 동료들은 유전적 상호작용이 개인의 유전형-표현형 관계를 해석하는 능력에 중요한 역할을 할 수 있다고 제안했습니다( Hartman et al. 2001). 이 아이디어는 이제 두 효모( Bloom et al. 2013) 및 인간 유전학자( Zuk et al. 2012) 수백만 개의 개별 인간 게놈의 임박한 시퀀싱과 관련성이 점점 더 높아질 것입니다. 전 세계 효모 유전자 네트워크의 범위와 폭을 감안할 때 입증해야 할 사항이 남아 있지만 유전적 상호 작용과 그 네트워크가 인간 질병 표현형의 상당 부분을 뒷받침해야 함을 가장 확실하게 예상할 수 있습니다. 다행히도 일반적으로 보존되는 것으로 보이는 유전 네트워크의 구조 및 토폴로지와 관련된 몇 가지 간단한 규칙이 있습니다. 특히, 경로 내의 유전자는 종종 일관된 방식으로 행동하며, 긍정적 또는 부정적 상호작용의 일관된 세트를 통해 다른 경로와 연결됩니다. 실제로, 효모 유전 네트워크에서 이러한 규칙을 외삽함으로써 Chad의 계산 팀은 인간의 게놈 전체 연관 연구(GWAS)에서 중요한 유전 상호 작용 신호를 감지하기에 충분한 통계적 능력을 가진 방법을 개발한 것으로 보입니다. 따라서 우리가 효모에서 배우는 유전적 네트워크의 기본적인 특성은 우리 자신의 게놈을 해석하는 데 중요할 수 있습니다.

Charlie Boone이 개척한 방법은 현재까지 알려진 생물학적 상호작용의 가장 풍부한 원천임이 입증되었으며 현대 유전 실험과 사고의 많은 부분을 주도하는 '상호작용체'의 기초입니다.

—재스퍼 라인, 캘리포니아 대학교 버클리

효모에서 개발된 시스템 수준의 기술과 그에 따른 게놈 규모의 데이터는 생물정보학 및 컴퓨터 생물학 분야에 활력을 불어넣었습니다. 실제로 기능 유전체학 데이터의 세부적인 계산 처리를 통해서만 그 잠재력을 충분히 실현할 수 있습니다. 그러나 정확하고 포괄적인 세포 모델을 구축하려면 기능 유전체학과 생물정보학의 경계를 계속 확장해야 합니다. 다음 단계에는 개별 연구소가 아닌 커뮤니티 수준에서 데이터를 수집하는 새로운 운영 모드가 필요하다고 생각합니다. 우리의 모든 연구 기업이 똑같은 세포에서 일하고 있기 때문에 고도로 조정된 이 다음 단계의 과학은 완전히 실현 가능합니다. 우리의 참조 균주인 S288c는 유전적 연속성을 제공합니다. 즉, 전 세계의 여러 실험실에서 파생된 정량적 게놈 규모 데이터를 통합 형식으로 컴파일하고 조합할 수 있습니다. 각 실험실이 특정 경로에 대한 전문 지식을 가지고 있으므로 정교한 경로별 판독값을 설계할 수 있다는 점을 감안할 때 우리 커뮤니티는 게놈 전체의 유전적 섭동 및 표준화된 환경 정황. 이 작업을 수행하는 방법은 정확하지 않지만 여러 가지 다양한 유형의 실험을 통해 이 분석 모드를 달성할 수 있다고 생각합니다. 포괄적인 돌연변이 세트의 진단 리포터( Jonikas et al. 2009년 비제아쿠마르 et al. 2010). 극복해야 할 기술적 도전이 분명히 있을 것이지만, 조정된 방식으로 전체 효모 연구 커뮤니티의 전문 지식과 힘을 활용하는 것은 정교한 CERN과 같은 과학의 생물학 버전의 궁극적인 시스템 수준 접근 방식을 나타냅니다.

효모 시스템 생물학 분야는 먼 길을 왔지만(Botstein and Fink 2011), 아마도 지금은 우리가 다음 단계를 밟아야 할 때입니다. 효모 커뮤니티는 생물학자와 이론가 모두가 진핵 세포의 모델링을 실현하는 데 필요한 종류의 데이터를 전달할 수 있어야 합니다.


결과

NS1-ATPase 활성은 다음에서 손상됩니다. yme1 세포: yme1 효모는 mtDNA가 없을 때 매우 느리게 성장합니다. 이 표현형은 ethidium bromide의 존재하에 세포를 배양함으로써 쉽게 채점되며, 이는 세포로부터 mtDNA의 양적 손실을 유발합니다(S lonimski et al. 1968 폭스 et al. 1991). 우리는 두 개의 F에서 우성 돌연변이를 확인했습니다.1 소단위, ATP1-75 그리고 ATP3-1, 이 작은 음성 표현형을 억제하는 yme1 균주(그림 1 W eber et al. 1995 K ominsky 및 Thorsness 2000). 이 관찰에 비추어 우리는 F를 조사했습니다.1NS0-야생형에서 분리한 미토콘드리아의 ATPase 활성, yme1, 그리고 yme1 몸집이 작은 음성 표현형의 억제제를 포함하는 균주. 온전한 미토콘드리아 게놈(ρ + )을 포함하는 균주 및 mtDNA(ρ°)가 없는 균주의 미토콘드리아는 결합된 F의 억제제인 ​​올리고마이신의 존재 및 부재 하에 분석되었습니다.1NS0-ATPase 활성. 그림 2A에서 볼 수 있듯이, 미토콘드리아 ATPase 활성 yme1 ρ + 세포는 야생형보다 15% 낮습니다. 이에 비해 억압된 yme1 ATP1-75 그리고 yme1 ATP3-1 균주는 미토콘드리아 ATPase 활성 수준의 현저한 증가를 나타내었으며, 이는 야생형보다 ~20% 더 높았다. 또한, 억제된 균주에서 총 미토콘드리아 ATPase 활성은 올리고마이신에 덜 민감했습니다. 커플링되지 않은 ATPase 활성, F1-ATPase는 2배 더 높았습니다. yme1 함유하는 효모 균주 ATP1-75 또는 ATP3-1 억제되지 않은 것보다 돌연변이 yme1 부담.

-의 억제 yme1 몸집이 작은 음성 표현형. 표시된 균주를 합성 글루코스 플레이트(A)가 없거나(B) 25㎍/ml 에티듐 브로마이드를 함유하는 합성 글루코스 플레이트에 스트리킹하고 30°에서 5일 동안 인큐베이션하였다. ethidium bromide의 존재하에서 효모의 성장은 mtDNA의 양적 손실을 유도합니다(S lonimski et al. 1968 폭스 et al. 1991). 균주는 다음과 같습니다. yme1△, PTY52 ATP1-75 yme1△, PTY93 ATP3-1 yme1△, PTY109 atp4△, DKY40 atp7△, DKY44 atp4yme1△, DKY48 atp7yme1△, DKY50 및 야생형, PTY44.

—ATPase 활성 yme1 누룩. 표시된 균주에서 분리된 5 마이크로그램의 ρ +(A) 또는 ρ°(B) 미토콘드리아를 삼중으로 분석했습니다. 데이터는 평균 +/- 평균의 표준 오차입니다. 억제된 ATPase 활성의 분율을 결정하기 위해 반응을 (-) 또는 올리고마이신(2 ㎍/ml) 없이 배양하였다. ATPase 특이적 활성은 [마이크로몰의 NSNS 단백질 1마이크로그램당 분당(×1000)]. 균주는 다음과 같습니다. yme1, PTY52 yme1 ATP3-1, PTY109 yme1 ATP1-75, PTY93 및 야생형, PTY44.

때문에 yme1 ρ° 효모는 생화학적 분석을 위해 ρ° 세포의 축적을 허용할 만큼 충분히 잘 자라지 않습니다. 우리는 25 μg/ml ethidium bromide를 첨가하여 ρ + 효모 배양에서 mtDNA의 손실을 빠르게 유도하는 계획을 고안했습니다. . 이 처리는 유전자외 억제제의 상당한 축적 없이 >90%의 세포질 소체를 생성하였다. 우리는 미토콘드리아 ATPase 활성과 올리고마이신에 민감하지 않은 F를 분석했습니다.1-야생형에서 ATPase 활성, yme1, 및 억제 yme1 이러한 방식으로 준비된 세포질 몸집이 작은 균주(그림 2B). 모든 균주에 대해 ρ° 세포의 총 미토콘드리아 ATPase 활성은 상응하는 ρ + 세포의 총 미토콘드리아 ATPase 활성과 본질적으로 변하지 않았다. 올리고마이신-불감성 F의 비율1-ATPase 활성은 그러나 ρ + 및 ρ° 세포에서 유의하게 달랐다. 일반적으로 균질한 ρ° 세포 집단에서 미토콘드리아 ATPase 활성은 커플링되지 않으므로 완전한 F가 없기 때문에 올리고마이신은 둔감합니다.0 복잡한. 이는 배치 에티듐 브로마이드 처리로부터 제조된 야생형 ρ° 세포에서 주로 관찰되며, 여기서 ATPase 활성의 66%는 올리고마이신에 둔감한 반면, ρ + 세포에서는 15%입니다. ρ° 야생형 세포에서 나머지 올리고마이신-민감성 ATPase 활성은 ρ° 세포의 불완전한 생산(최대 10%의 세포가 에티듐-브로마이드 처리 배양물에서 ρ+임) 및 잔류 미토콘드리아로 코딩된 단백질의 존재를 반영할 가능성이 있습니다. ethidium-bromide 처리된 배양물의 성장 동안 유지됩니다. 야생형과 달리 ATPase 활성은 40%에 불과합니다. yme1 ρ° 미토콘드리아는 올리고마이신에 둔감합니다. 이는 상당한 비율의 F가1 복합체는 여전히 F에 결합되어 있습니다.0 소단위 yme1 누룩. 미토콘드리아 ATPase 활성 yme1 돌연변이를 억제하는 ρ° 세포 ATP1 그리고 ATP3 ρ + 균주에서와 같이 야생형 또는 yme1 누룩. 이들 억제된 ATPase 활성의 대부분은 yme1 균주는 올리고마이신에 민감하지 않은 F1-ATPase 활성, 야생형에 해당.

—야생형에서 Atp1p 및 Atp2p의 정량 및 yme1 누룩. (A) 미토콘드리아 단백질의 면역검출. 표시된 균주에서 약 15μg의 미토콘드리아가 변성 7.5% 폴리아크릴아미드 겔에서 분해되었습니다. 단백질을 니트로셀룰로오스로 옮기고 F의 α- 및 β-서브유닛에 대한 항체로 조사했습니다.1NS0-ATPase(각각 Atp1p 및 Atp2p) 및 Arg8p, 미토콘드리아 기질에서 발견되는 단백질. (B) 야생형에서 Atp1p 및 Atp2p의 상대 농도 및 yme1 누룩. Bio-Rad의 Molecular Analyst 소프트웨어를 사용하여 A의 오점을 디지털화하고 상대 신호를 정량화했습니다. 샘플 농도의 차이를 제어하기 위해 각 레인에서 Atp1p와 Atp2p의 상대적인 양을 Arg8p의 양으로 정규화했습니다. Arg8p, Atp1p 및 Atp2p의 야생형 농도는 100으로 설정되었습니다. 균주: 야생형, PTY44 yme1, PTY52 yme1 ATP1-75, PTY93 및 yme1 ATP3-1, PTY109.

감소된 F1NS0-ATPase 활성 yme1 효모는 F 수치 감소의 결과일 수 있습니다.1NS0-ATPase 복합체, F의 억제 증가1NS0-ATPase, 또는 둘의 조합. 마찬가지로, 증가된 F1NS0-억제된 균주의 ATPase 활성(yme1 ATP1-75 그리고 yme1 ATP3-1) 활성을 증가시키는 단백질 구조의 변화, F 축적 증가의 결과일 수 있습니다.1NS0-ATPase 단백질, 또는 둘의 조합. 결과적으로 F의 양1NS0-ATPase 소단위 α(Atp1p) 및 β(Atp2p)는 니트로셀룰로오스에 결합된 미토콘드리아 단백질 추출물의 면역검출을 사용하여 결정되었습니다(그림 3). 각 균주에서 발견된 Atp1p 및 Atp2p의 농도를 비교하기 위해 관련 없는 미토콘드리아 단백질 Arg8p의 상대 농도를 결정하고 샘플 농도의 차이를 수정하는 데 사용했습니다(그림3B). ρ + 셀에서, yme1 효모 세포는 Atp1p와 Atp2의 양이 약간 감소할 뿐이며, 이는 yme1 미토콘드리아는 효소 활성의 억제 때문입니다. 대조적으로, Atp1p와 Atp2p의 양은 6배 감소했습니다. yme1ATP1-75 이 세포에는 20% 더 많은 F가 있지만 효모1NS0-야생형보다 ATPase 활성이 있습니다(그림 2A). 결과적으로 F의 회전율1NS0- ATP 가수분해에 대한 ATPase yme1ATP1-75 스트레인은 >16배 증가했습니다. 유사하게, yme1ATP3-1 균주는 Atp1p의 상대 농도에서 약간의 감소를 나타내었고 결과적으로 ATPase 회전율이 약간 증가했으며, 이는 야생형 F보다 대략 3배 더 큽니다.1NS0-ATPase.

- F의 누적0 소단위 yme1 누룩. 표시된 균주의 미토콘드리아 15마이크로그램을 변성 12% 폴리아크릴아미드 겔에서 분리했습니다. 단백질을 니트로셀룰로오스로 옮기고 Atp4p(anti-su 4) 및 Atp7p(anti-su 7)에 대한 항체로 조사했습니다. (A) ρ + 미토콘드리아. (B) ρ° 미토콘드리아. 균주: wt, PTY44 yme1, PTY52 yme1 ATP3-1, PTY109 및 yme1 ATP1-75, PTY93.

NS0 소단위 축적 yme1 ρ° 세포: 이전 연구에서는 F1 하위 단위인 Atp3p 및 Atp1p는 Yme1p 종속 방식으로 전환됩니다(W eber et al. 1995). 또한 정상보다 높은 비율의 올리고마이신 민감성 ATPase 활성이 존재합니다. yme1 ρ° 효모는 F1 미토콘드리아의 복합체는 여전히 F와 상호 작용할 수 있습니다.0 소단위. 따라서 우리는 F의 운명을 조사했습니다.0 소단위 yme1 세포. 면역 검출 실험은 F의 두 서브유닛인 Atp4p 및 Atp7p에 대한 다클론 항체를 사용하여 수행되었습니다.0 복잡한. 도 4A에서 보는 바와 같이, 야생형에서 분리한 ρ + 미토콘드리아에서 이들 단백질의 농도에는 차이가 없으며, yme1, 또는 억제 yme1 누룩. 그러나 Atp4p와 Atp7p는 모두 yme1 ρ° 효모 뿐만 아니라 yme1 ATP1-75 그리고 yme1 ATP3-1 돌연변이(그림 4B). 다른 연구자들은 F의 Yme1p 의존적 회전율에 주목했습니다.0 서브유닛 4, 5, 6, 17 in 옥사1Δ 효모 균주(L emaire et al. 2000).

— ρ + 효모에 석시네이트를 첨가하여 내부 미토콘드리아 막 전위 생성. ρ + 미토콘드리아는 야생형에서 분리되었으며, yme1, 및 억제 yme1 ATP3-1 그리고 yme1 ATP1-75 누룩. 3,3'-디프로필티오카르보시아닌 요오드화물의 잠재적 의존적 흡수는 상대 형광의 백분율로 표시됩니다. 트리스-숙시네이트의 첨가 시점은 S로 표시되고, 언커플러 카르보닐 시안화물의 첨가 시점은 미디엄-클로로페닐히드라존은 C로 표시됩니다. 균주: 야생형 ρ + , PTY44 yme1 ρ + , PTY52 yme1 ATP3-1 ρ + , PTY109 및 yme1 ATP1-75 ρ + , PTY93.

To determine whether the accumulation of Atp4p or Atp7p was the basis for the abnormally high proportion of oligomycin-sensitive ATPase activity of yme1 ρ° yeast, we tested whether a null mutation in ATP4 및/또는 ATP7 suppressed the yme1 petite-negative phenotype. Neither the atp4yme1 그리고 atp7yme1 double mutants (Figure 1) nor the atp4atp7yme1 triple mutant (data not shown) grew in the absence of mtDNA thus these mutations did not suppress the yme1 ρ° lethality. NS atp4△ 및 atp7Δ mutants alone displayed no phenotype in the absence of mtDNA. It is possible that other F0 subunits may be involved in yme1 ρ° lethality, as four additional F0 subunits are encoded in the nucleus. Alternatively, accumulation of F0 subunits in yme1 yeast may be a separate phenomenon from that of the petite-negative phenotype of these cells.

The inner mitochondrial membrane potential is diminished in yme1 yeast: Inactivation of ATP synthase F1 subunits coupled with the loss of mtDNA results in a decrease of the inner mitochondrial membrane potential (G iraud and V elours 1997). Because the petite-negative phenotype of yme1 yeast can be rescued by mutations in two F1 proteins, we examined the membrane potential in yme1 세포. Changes in the membrane potential of mitochondria isolated from ρ + yeast in response to the addition of succinate were monitored by measuring the uptake of the fluorescent dye 3,3′-dipropylthiocarbocyanine iodide. These changes were recorded after the addition of a substrate, tris-succinate, and after the addition of an uncoupler, carbonyl cyanide 미디엄-chlorophenylhydrazone. Mitochondria prepared from the yme1 ρ + , yme1 ATP3-1 ρ + , and yme1 ATP1-75 ρ + mutant strains all exhibit a reduction of membrane potential relative to wild type as judged by the relative change in fluorescence upon addition of the uncoupler (Figure 5).

The ability to generate a membrane potential in response to succinate is dependent upon electron transport, a feature absent in ρ° cells. Instead, the generation of membrane potential in ρ° mitochondria is created by the flux of ATP and ADP through the ATP/ADP translocator (G iraud and V elours 1997). Consequently, we examined the ability of wild-type and mutant yeast strains to generate a membrane potential using ATP by monitoring fluorescence of rhodamine 123 (Figure 6). Wild-type ρ + and ρ° mitochondria generated a membrane potential in response to added ATP, as indicated by the decrease in relative fluorescence (Figure 6A). The membrane potential was destroyed by the addition of the ionophore valinomycin, and the magnitude of the membrane potential can be judged by the relative change in fluorescence that occurred in response to addition of valinomycin. The greater membrane potential in ρ + as compared to that of ρ° mitochondria is probably a reflection of both the flux of ATP/ADP through the translocator and the ability to pump protons out of mitochondria upon ATP hydrolysis by the F1NS0-ATPase. Strikingly, yme1 mitochondria, whether ρ + or ρ°, did not generate a membrane potential in response to the addition of ATP, and the small potential present before the addition of ATP was actually destroyed (Figure 6B) by the addition of ATP. Mitochondria prepared from ρ + and ρ° yme1 strains bearing a suppressing mutation in the α-subunit of ATP synthase (yme1 ATP1-75 strains) once again generated a membrane potential in response to ATP (Figure 6C). The ρ° mitochondria from wild-type or yme1 ATP1-75 yeast, whether prepared from clonal ρ° cultures (Figure 6C) or from ρ + strains treated with ethidium bromide (data not shown), generated a membrane potential in response to ATP. Hence, the petite-negative phenotype of yme1 yeast is likely due to the inability of the mitochondria to generate a membrane potential in response to ATP.

—Generation of an inner mitochondrial membrane potential in ρ + and ρ° yeast by addition of ATP. Mitochondria were isolated from wild-type, yme1, 그리고 yme1 ATP-75 누룩. The ρ° mitochondria prepared from wild-type and yme1 ATP1-75 strains are quantitatively ρ°. The ρ° mitochondria prepared from the yme1 strain were generated from a batch culture of ρ + cells by treatment with ethidium bromide. The potential dependent quenching of rhodamine 123 fluorescence is expressed as percentage of relative fluorescence. ATP was added at ∼240 sec, and the ionophore valinomycin was added at ∼420 sec. Strains: wild-type ρ + , PTY44 wild-type ρ°, PTY44ρ° yme1 ρ + , PTY52 yme1 ρ°, PTY52ρ° yme1 ATP1-75 ρ + , PTY93 and yme1 ATP1-75 ρ°, PTY93ρ°.

삭제 INH1 partially suppresses the petite-negative phenotype of yme1 ρ° cells: Mitochondrial ATPase activity in ρ° cells is necessary for the generation of a membrane potential in mitochondria (G iraud and V elours 1997). Since a yme1 strain has low ATPase activity compared to that of wild-type strains and since suppressing mutations of the α- and γ-subunits of F1-ATPase subunits lead to an increase in ATPase activity, it is possible that an inhibitor of F1-ATPase accumulates in yme1 균주. The accumulation of an F1-ATPase inhibitor might contribute to the ρ° slow-growth phenotype of the yme1 돌연변이. Several small peptides encoded in the nucleus of yeast inhibit F1-ATPase activity. INH1 encodes an intrinsic F1NS0-ATPase inhibitor (I chikawa et al. 1990 Y oshida et al. 1990). Inactivation of INH1 shows no phenotype in otherwise wild-type yeast and has been proposed to inhibit the F1NS0-ATPase when the F1 그리고 에프0 portions of the ATPase are uncoupled. Inactivation of INH1 안에 yme1 background partially complemented the ρ° slow-growth phenotype (Figure 7). Two other nuclear genes, TIM11 그리고 STF1, also affect F1NS0-ATPase activity. TIM11 encodes a protein necessary for the assembly of F1NS0-ATPase into dimers (A rnold et al. 1998), and STF1 encodes a protein with sequence similarity to INH1 (A kashi et al. 1988). When we tested whether a TIM11 deletion (Figure 7) or a STF1 deletion (data not shown) rescued the yme1 ρ° slow-growth phenotype, neither of these mutations, singly or in combination with each other or with inh1Δ, complemented the yme1 ρ° slow-growth phenotype (Figure 7 and data not shown). 삭제 INH1, TIM11, 또는 STF1 did not create a slow-growth phenotype in otherwise wild-type ρ° strains (Figure 7 and data not shown).

—Inactivation of an endogenous F1NS0-ATPase inhibitor partially suppresses the yme1 ρ° slow-growth phenotype. The indicated yeast strains were cultured on (A) synthetic glucose media (SD) or (B) synthetic glucose media that contained 25 μg/ml ethidium bromide (SD + EtBr) for 5 days at 30°, creating ρ° strains. Strains: wild type, PTY44 inh1Δ, PTY190 tim11Δ, PTY191 inh1tim11Δ, PTY192 yme1Δ, PTY52 yme1inh1Δ, PTY193 yme1tim11Δ, PTY194 and yme1inh1tim11Δ, PTY195.


소개

While direct investigation of human biology can often be limited due to practical or ethical considerations, the wide array of model organisms available to researchers has allowed a remarkable amount of discovery into our own molecular functioning. All living organisms share commonalities in their underlying molecular makeup thus, knowledge of processes studied in one organism can often be translated to others. Eukaryotic microorganisms, with replication times and tractability akin to bacteria, but much more overlap in cellular components to humans, have proven especially useful in studying human biology. Chief among these, the budding yeast 사카로마이세스 세레비지애 has been an invaluable tool for uncovering much of the basic biology that underlies human cell functioning and disease.

The last common ancestor of humans and yeast is estimated to have lived approximately a billion years ago [ 1], and we still share a substantial portion of our genetic material. The human genome contains roughly 20 000 protein-coding genes while the yeast genome comprises about 6000. A pairwise comparison of genes between the species reveals ∼2100 groups of orthologs, representing 2300 yeast genes and 3900 human genes [ 2] ( Figure 1). Many shared genes perform important cellular roles in both organisms, and their perturbation leads to diverse human disorders, from cancer to Mendelian diseases. The homology between humans and yeast, and the inherent tractability of yeast, has enabled researchers to expand its usefulness as a model for human biology, both by heterologous expression of human proteins, as well as by directly modifying yeast cells to humanize specific amino acids, proteins or even entire yeast pathways ( Figure 2).

Humans and yeast share thousands of orthologous genes. The Venn diagram illustrates counts of human–yeast orthologs [ 2], grouped according to the nature of the orthology (classifying orthologs according to whether their count in humans:yeast is 1:1, many:1, or many:many) and whether the yeast genes are essential or not under standard laboratory growth conditions [ 3]. (A colour version of this figure is available online at: http://bfg.oxfordjournals.org)

Humans and yeast share thousands of orthologous genes. The Venn diagram illustrates counts of human–yeast orthologs [ 2], grouped according to the nature of the orthology (classifying orthologs according to whether their count in humans:yeast is 1:1, many:1, or many:many) and whether the yeast genes are essential or not under standard laboratory growth conditions [ 3]. (A colour version of this figure is available online at: http://bfg.oxfordjournals.org)

Five degrees of yeast humanization. Yeast have proven useful for the direct study of human biology in a variety of forms, illustrated here to distinguish those cases in which yeast were simply studied for human-specific processes and drugs (degree 0), to the heterologous expression of human genes in yeast (degree 1), all the way to the directed replacement of specific amino acids, genes, and pathways (degrees 2–4, respectively). (A colour version of this figure is available online at: http://bfg.oxfordjournals.org)

Five degrees of yeast humanization. Yeast have proven useful for the direct study of human biology in a variety of forms, illustrated here to distinguish those cases in which yeast were simply studied for human-specific processes and drugs (degree 0), to the heterologous expression of human genes in yeast (degree 1), all the way to the directed replacement of specific amino acids, genes, and pathways (degrees 2–4, respectively). (A colour version of this figure is available online at: http://bfg.oxfordjournals.org)

Two early successes in humanization were demonstrated in 1985 and 1987 as a means of identifying human genes capable of rescuing yeast mutants: First, Kataoka . [ 4] expressed chimeric yeast/human or full human RAS genes in yeast Δras mutants to demonstrate the functional homology retained between the two species. Next, in a famous and elegant experiment to identify human genes possessing the same function as fungal CDC2, Lee and Nurse [ 5] expressed a large library of human cDNAs in fission yeast (Schizosaccharomyces pomb), to identify an orthologous protein capable of rescuing a S. pombe Δcdc2 돌연변이.

In the 30 years since these experiments, more than 400 yeast genes have been humanized [ 6–8]. Studies have ranged in their degree of direct translation to humans, from using yeast proteins to identify targets for human drugs to large-scale replacement of yeast genes with their human orthologs [ 9]. In this review, we discuss these ongoing efforts to develop and utilize humanized yeast, and their increased emphasis on high-throughput construction and applications. We consider five ‘degrees' of humanization, representing increasing levels by which the yeast have been altered to resemble the human case ( Figure 2).


재료 및 방법

Strains and media

Yeast strains 779-6A (매트NS, kar1-1, SUQ5, ade2-1, his3202, leu21, trp163, ura3-52) (Jung and Masison, 2001 ) and W303 (매트NS, ade2-1, 우라3-1, his3-11, trp1-1, leu2-3, leu2-112, can1-100, GAL, SUC) (ATCC 208 352) were used. The 779-6A strain used throughout this study is [PSI + ], since it contained the prion form of the Sup35 protein. The W303 strain is used commonly in yeast research. HSP104 was deleted in strain 779-6A by transformation, using a PCR-amplified KanMX disruption cassette from a yeast deletion strain (ATCC) (Jones et al., 2004). Yeast were grown at 30 °C in SD (synthetic defined Sunrise Science Products) medium containing 2% glucose, 7 g/l yeast nitrogen base (YNB Sunrise Science Products) and the appropriate complete supplement mixture (CSM) to maintain plasmid(s) selection. YPD medium contains 1% yeast extract, 2% peptone and 2% dextrose. 1/2YPD is similar to YPD but contains 0.5% yeast extract. The galactose medium contains 2% galactose and 2% raffinose in place of glucose. Cultures were maintained in log phase (OD600 < 0.6) by periodic dilution with fresh medium. 대장균 strain DH5α was used for plasmid propagation.

Plasmid constructions

HSP104 (position − 844 to + 2965) flanked by FRT sites was amplified from genomic DNA of S. 세레비지애 strain 779-6A with the primer pair HSP104-1 (5′-ta ggatcc gaagttcctattctctagaaagtataggaacttcgactg ctcttgcacagaacctccc-3′) and HSP104-2 (5′-ta ctcgag gaagttcctatactttctagagaataggaacttcctttagttatcaacgcc atatgtccc-3′). The PCR product was digested with 안녕 그리고 XhoI and cloned in pRS314 to generate pC4F-HSP104. To construct pC4FURA3, KpnNS-SacNS URA3 (from − 225 to + 63) fragment flanked by 34 bp FRT was amplified by PCR from the plasmid pRS316 with the primer pair URA3–7 (5′-at gagctc gaagttcctattctctagaaagtataggaacttc gggccc ttttc aattcaattcatcatttttttt-3′) and URA3-8 (5′-at ggtacc ga agttcctatactttctagagaataggaacttc cggccg taataactgatat aattaaattga-3′), digested with KpnNS-SacI and inserted into the plasmid pRS314. NS 아파NS-아니다NS URA3 fragment in plasmid pC4FURA3 was replaced with 아파NS-EagI-digested m ulti- c loning s ite (MCS) from the plasmid pRS314 and this resulted in pC4FMCS. Plasmid pC4FGFP was constructed by inserting 아파NS-아니다I fragment from pJ543 containing the ORF of GFP, which is under the control of SUP35 promoter (from − 600 to − 2), and fused to SUP35 terminator (182 bp of 3′ UTR), into the 아파NS-EagI-digested pC4FMCS. 의 ORF FLP was amplified from plasmid pTET23 (Park and Morschhauser, 2005 ) by using the primer pair FLP2 (tata ggatcc atgtcacaatttgatatattatgtaaaacacc) and FLP3 (tata cccggg ttatatgcgtctatttatgtaggatgaaag g), then inserted into XhoNS-HI-digested GAL1 promoter fragment and 크리스마스NS-SacI terminator fragment of HSP104 ~ 안으로 XhoNS-SacI-digested pRS315 to create pC5GAL1–FLP. Underlined sequences in the primers indicate the inserted restriction sites. All sequences have been verified. All the backbone plasmids have been described in detail (Sikorski and Hieter, 1989 ).

Determination of pre-excision rate under non-inducing conditions

To determine the [PSI + ]/[psi − ] phenotype, cells of the Δhsp104 [PSI + ] strain having plasmids pC4F-HSP104 and pC5GAL1–FLP were grown in SD—Trp—Leu drop-out medium to mid-log phase and then plated onto SD—Trp—Leu drop-out agar plate containing 10 µg/ml adenine. After 5 days of incubation at room temperature, the percentage of [psi − ] red colonies, which represents the pre-excision rate of HSP104, was determined. The determined data include some ‘spontaneous’ prion loss, whose frequency, determined by the strain having only pC4F-HSP104, was < 0.2%, could be due to increased Hsp104 in cells that have more than one copy of the plasmid.

Measurement of URA3 gene-flipping efficiency

Cells of strain 779-6A or W303 having plasmids pC4FURA3 and pC5GAL1–FLP grown in SD—Trp—Leu—Ura drop-out medium were transferred into similar SD-Trp-Leu medium with galactose in place of dextrose to induce Flp recombinase. During growth in galactose medium, aliquots of cells at the indicated generations (see Results), as determined by doubling of OD600, were plated onto both YPD and uracil drop-out agar plates. To calculate the number of cells per 1 ml culture, cells in the aliquot were counted using a cell-counting chamber (Neubauer, 0.0025 mm 2 ). After 3 days of incubation at 30 °C, the colonies were counted and the excision rate was calculated as colony number on uracil drop-out agar plates vs colony number on YPD plates, or the counted cell number.

이미징

The GFP fluorescence in yeast was imaged using the Zeiss LSM510 confocal microscope with a × 63 objective. The same settings were used for imaging the GFP fluorescence in the different strains throughout the experiment.


Synopsis

A major goal of systems biology is to uncover the underlying structure of biological networks in order to develop comprehensive models of biological processes that are both accurate and predictive. In addition to genes that perform a single function, genetic networks also contain genes that perform many functions. To date, the network architecture of these multi-function or pleiotropic genes has not been well characterized. This study uses a combination of functional genomics and computational methods to reveal a non-trivial organization of highly pleiotropic genes in the important model organism S. 세레비지애.

Pleiotropy is a relatively common, but poorly understood phenomenon in biology defined as the ability of a mutation in a single gene to produce multiple effects 생체 내. The prevalence of pleiotropy is perhaps most striking in the growing number of human diseases for which a mutation in a single gene produces a broad and seemingly unrelated set of symptoms ( Brunner and van Driel, 2004 ). In yeast, the availability of resources such as a complete set of isogenic deletion mutants ( Giaever et al., 2002 ) makes it possible to identify a comprehensive set of genes required for growth under a given environmental condition. To facilitate such genome-wide mutant analysis under a large number of conditions, we developed a cost-effective strategy to measure the growth of individual strains on standard agar plates. We used this method to assay the complete set of non-essential yeast gene deletions (4,700 mutants) under 21 environmental conditions in duplicate (>10 5 data points) and identified 216 highly pleiotropic mutants with growth defects in 3 or more conditions.Figure 6

It has long been hypothesized that pleiotropy, while frequently observed, poses significant disadvantages for the evolvability of an organism, including limiting the rate of adaptation and reducing the level of adaptation for some traits in response to selection for others ( Otto, 2004 ). By generating phenotype data for a relatively large number of conditions we were able to make an initial estimate of the overall degree of pleiotropy in yeast. We assessed the level of pleiotropy in our data by counting the number of phenotypes observed for each mutant. The results (Figure 8) show that approximately 70% of the mutants have a relatively low degree of pleiotropy, with phenotypes in only one or two conditions, and the remaining 30% are highly pleiotropic, with growth defects in as many as 14 conditions. To test the statistical significance of this amount of pleiotropy, we compared our data to a randomly generated distribution of phenotypes per mutant (Figure 8). A statistical comparison of these distributions demonstrates that the degree of pleiotropy we observe in an important model organism, 사카로마이세스 세레비지애, is significantly greater than can be explained by chance. These results, support the hypothesis that pleiotropy plays an important role in biological systems.

Our work also yields a number of widely applicable technical advances that have the potential to meet one of the greatest challenges in understanding pleiotropic genes—determining whether the phenotypes associated with a mutation are the result of the loss of a single function or of multiple functions encoded by the same gene. In human disease research, understanding gene function at this level provides important information relevant for devising effective treatments and analyzing drug side-effects. Unfortunately, classical approaches for dissecting the behavior of pleiotropic genes, such as searching for multiple alleles of a gene that exhibit different phenotypes, are time-consuming and often not feasible in a clinical setting. To address this problem, we developed a method for determining the association between gene functions and mutant phenotypes based on a single mutant allele, such as a complete gene deletion.

The strong link between mutant phenotype and cellular function suggests that high throughput methods for measuring phenotypes may be used to identify such functions 드 노보. In our study, we identified groups of mutants that shared a statistically significant set of phenotypes. The high degree of overlap between these clusters and known biological process annotations, synthetic lethal interactions, and protein complexes supported the hypothesis that this high throughput, unsupervised method can be used to discover genetically defined functional categories. Application of these functional predictions to the phenotype profiles of the highly pleiotropic mutants allowed us to generate hypotheses about the number of functions carried out by these genes and the conditions under which they are required (Figure 6). While extremely powerful in yeast, these methods hold even greater promise for analysis in organisms that are less genetically tractable, such as mammalian cell lines in which endogenous genes can be silenced using RNAi technology ( Schutze, 2004 ).


내용물

S. 세레비지애 (효모)는 이배체 또는 반수체로 안정적으로 존재할 수 있습니다. 반수체 및 이배체 효모 세포는 모두 유사 분열에 의해 번식하며 딸 세포는 모세포에서 싹을 틔웁니다. 반수체 세포는 반대 교배 유형의 다른 반수체 세포와 교배할 수 있습니다. NS 세포는 α 세포와만 교미할 수 있으며, 그 반대의 경우도 마찬가지) 안정한 이배체 세포를 생성합니다. 일반적으로 영양 고갈과 같은 스트레스가 많은 조건에 직면했을 때 이배체 세포는 감수 분열을 거쳐 4개의 반수체 포자를 생성할 수 있습니다: 2개의 a 포자와 2개의 α 포자.

Α 셀과 α 셀의 차이점

NS 세포는 'NS-인자', 짝짓기 페로몬의 존재 신호 NS 이웃하는 α 세포에 세포. NS 세포는 α-인자의 근원을 향해 돌출부(Al Capp 만화 캐릭터 Shmoo를 닮은 독특한 모양으로 인해 shmoo로 알려짐)를 성장시킴으로써 α 세포 짝짓기 페로몬인 α-인자에 반응합니다. 유사하게, α 세포는 α-인자를 생성하고, NS- 페로몬의 근원을 향한 투영을 성장시켜 요인. 반대 짝짓기 유형의 짝짓기 페로몬에만 반수체 세포의 반응은 짝짓기를 허용합니다. NS 및 α 세포, 그러나 동일한 교배 유형의 세포 사이는 아닙니다.

이러한 표현형 차이는 NS α 세포는 두 가지 교배 유형의 세포에서 활발하게 전사되고 억제되는 다른 유전자 세트로 인한 것입니다. NS 세포는 생산하는 유전자를 활성화 NS-인자 및 α-인자에 결합하고 세포 내 신호 전달을 유발하는 세포 표면 수용체(Ste2)를 생성합니다. NS 세포는 또한 α 세포와 관련된 유전자를 억제합니다. 유사하게, α 세포는 α-인자를 생성하는 유전자를 활성화하고 이에 결합하고 반응하는 세포 표면 수용체(Ste3)를 생성합니다. NS-인자 및 α 세포는 다음과 관련된 유전자를 억제합니다. NS 셀.

NS 매트 궤적 편집

특징을 나타내는 다양한 전사 억제 및 활성화 세트 NS α 세포는 매트: 매트NS 또는 MATα 염색체 III에 위치. MAT 유전자좌는 일반적으로 두 짝짓기 유형 간에 공유되는 시퀀스를 기반으로 5개 영역(W, X, Y, Z1 및 Z2)으로 나뉩니다. 차이점은 Y 영역(YNS 및 Yα), 대부분의 유전자 및 프로모터를 포함합니다.

NS 매트NS allele of 매트 라고 불리는 유전자를 암호화 NS1, 반수체에서 전사를 지시하는 NS-특정 전사 프로그램(예: STE2 그리고 억압 STE3) 정의 NS 셀. NS MATα allele of 매트 반수체에서 α-특이적 전사 프로그램의 전사를 지시하는 α1 및 α2 유전자를 암호화합니다. STE3, 억압 STE2) 세포를 α 세포로 만듭니다. [2] S. 세레비지애 has an NSα2와 서열의 많은 부분을 공유하는 명백한 기능이 없는 2 유전자 그러나 다른 효모는 다음과 같습니다. 칸디다 알비칸스 기능적이고 뚜렷한 MAT가 있어야 합니다.NS2 유전자. [3] [4]

반수체와 이배체 세포의 차이점

반수체 세포는 두 가지 짝짓기 유형 중 하나입니다(NS 또는 α), 반대 교배 유형의 반수체 세포에 의해 생성된 교미 페로몬에 반응하고 반대 교배 유형의 세포와 교미할 수 있습니다. 반수체 세포는 감수 분열을 겪을 수 없습니다. 이배체 세포는 짝짓기 페로몬을 생성하거나 반응하지 않으며 짝짓기를 하지 않지만 감수분열을 거쳐 4개의 반수체 세포를 생성할 수 있습니다.

반수체의 차이처럼 NS 및 α 세포, 유전자 억제 및 활성화의 다른 패턴은 반수체와 이배체 세포 사이의 표현형 차이에 대한 책임이 있습니다. 그 외에 구체적인 NS 및 α 전사 패턴, 두 교배 유형의 반수체 세포는 반수체 특이적 유전자(예: ) 및 이배체 특이적 유전자(예: IME1). 유사하게, 이배체 세포는 이배체 특이적 유전자를 활성화하고 반수체 특이적 유전자를 억제합니다.

반수체와 이배체의 다른 유전자 발현 패턴은 다시 매트 현장. 반수체 세포는 16개의 염색체 각각에 대해 하나의 사본만 포함하므로 다음 중 하나의 대립유전자만 가질 수 있습니다. 매트 (어느 하나 매트NS 또는 MATα), 이는 짝짓기 유형을 결정합니다. 이배체 세포는 짝짓기의 결과입니다. NS 세포와 α 세포, 따라서 32개의 염색체(16쌍)를 가지고 있으며, 여기에는 다음을 포함하는 하나의 염색체가 포함됩니다. 매트NS 대립 유전자와 다른 염색체 MATα 대립 유전자. 에 의해 인코딩된 정보의 조합 매트NS 대립유전자( NS1 유전자) 및 MATα 대립 유전자(α1 및 α2 유전자)는 이배체 전사 프로그램을 촉발합니다. 유사하게, 단 하나의 대립유전자의 존재 매트, 여부 매트NS 또는 MATα, 반수체 전사 프로그램을 트리거합니다.

에 존재하는 대립유전자 매트 궤적은 세포의 짝짓기 동작을 프로그래밍하기에 충분합니다. 예를 들어 유전자 조작을 사용하여 매트NS 대립 유전자를 추가할 수 있습니다. MATα 반수체 세포. 염색체의 반수체 보체를 가지고 있음에도 불구하고, 세포는 이제 두 가지 모두를 가지고 있습니다. 매트NS 그리고 MATα 대립형질이며 이배체 세포처럼 행동합니다. 짝짓기 페로몬을 생성하거나 반응하지 않으며, 굶어죽으면 감수분열을 시도하여 치명적인 결과를 초래합니다. 마찬가지로 사본 하나를 삭제하면 매트 이배체 세포의 유전자좌는 하나만 남기고 매트NS 또는 MATα 대립 유전자는 염색체의 이배체 보체를 가진 세포가 반수체 세포처럼 행동하도록 합니다.

효모에서의 교미는 Ste2 수용체(α-세포) 또는 Ste3 수용체(α-세포)에 결합하는 페로몬의 존재에 의해 자극됩니다. 이 페로몬의 결합은 이종삼량체 G 단백질의 활성화로 이어집니다. The dimeric portion of this G-protein recruits Ste5 (and its related MAPK cascade components) to the membrane, and ultimately results in the phosphorylation of Fus3.

The switching mechanism arises as a result of competition between the Fus3 protein (a MAPK protein) and the phosphatase Ptc1. These proteins both attempt to control the 4 phosphorylation sites of Ste5, a scaffold protein with Fus3 attempting to phosphorylate the phosphosites, and Ptc1 attempting to dephosphorylate them.

Presence of α-factor induces recruitment of Ptc1 to Ste5 via a 4 amino acid motif located within the Ste5 phosphosites. Ptc1 then dephosphorylates Ste5, ultimately resulting in the dissociation of the Fus3-Ste5 complex. Fus3 dissociates in a switch-like manner, dependent on the phosphorylation state of the 4 phosphosites. All 4 phosphosites must be dephosphorylated in order for Fus3 to dissociate. Fus3's ability to compete with Ptc1 decreases as Ptc1 is recruited, and thus the rate of dephosphorylation increases with the presence of pheromone.

Kss1, a homologue of Fus3, does not affect shmooing, and does not contribute to the switch-like mating decision.

In yeast, mating as well as the production of shmoos occur via an all-or-none, switch-like mechanism. This switch-like mechanism allows yeast cells to avoid making an unwise commitment to a highly demanding procedure. However, not only does the mating decision need to be conservative (in order to avoid wasting energy), but it must also be fast to avoid losing the potential mate.

The decision to mate is extremely sensitive. There are 3 ways in which this ultrasensitivity is maintained:

  1. Multi-site phosphorylation – Fus3 only dissociates from Ste5 and becomes fully active when all 4 of the phosphosites are dephosphorylated. Even one phosphorylated site will result in immunity to α-factor.
  2. Two-stage binding – Fus3 and Ptc1 bind to separate docking sites on Ste5. Only after docking can they bind to, and act on, the phosphosites.
  3. Steric hindrance – competition between Fus3 and Ptc1 to control the 4 phosphosites on Ste3

[a and α yeast share the same mating response pathway, with the only difference being the type of receptor each mating type possesses. Thus the above description, given for a-type yeast stimulated with α-factor, works equally well for α-type yeast stimulated with a-factor.]

Wild type haploid yeast are capable of switching mating type between NS and α. Consequently, even if a single haploid cell of a given mating type founds a colony of yeast, mating type switching will cause cells of both NS and α mating types to be present in the population. Combined with the strong drive for haploid cells to mate with cells of the opposite mating type and form diploids, mating type switching and consequent mating will cause the majority of cells in a colony to be diploid, regardless of whether a haploid or diploid cell founded the colony. The vast majority of yeast strains studied in laboratories have been altered such that they cannot perform mating type switching (by deletion of the gene [5] see below) this allows the stable propagation of haploid yeast, as haploid cells of the NS mating type will remain NS cells (and α cells will remain α cells), and will not form diploids.

HML 그리고 HMR: the silent mating cassettes Edit

Haploid yeast switch mating type by replacing the information present at the 매트 현장. For example, an NS cell will switch to an α cell by replacing the 매트NS allele with the MATα 대립 유전자. This replacement of one allele of 매트 for the other is possible because yeast cells carry an additional silenced copy of both the 매트NS 그리고 MATα alleles: the HML (시간omothallic 미디엄ating eft) locus typically carries a silenced copy of the MATα 대립 유전자, 그리고 HMR (시간omothallic 미디엄ating NSight) locus typically carries a silenced copy of the 매트NS 대립 유전자. The silent HML 그리고 HMR loci are often referred to as the silent mating cassettes, as the information present there is 'read into' the active 매트 현장.

These additional copies of the mating type information do not interfere with the function of whatever allele is present at the 매트 locus because they are not expressed, so a haploid cell with the 매트NS allele present at the active 매트 locus is still an NS cell, despite also having a (silenced) copy of the MATα allele present at HML. Only the allele present at the active 매트 locus is transcribed, and thus only the allele present at 매트 will influence cell behaviour. Hidden mating type loci are epigenetically silenced by SIR proteins, which form a heterochromatin scaffold that prevents transcription from the silent mating cassettes.

Mechanics of the mating type switch Edit

The process of mating type switching is a gene conversion event initiated by the 유전자. NS gene is a tightly regulated haploid-specific gene that is only activated in haploid cells during the G1 phase of the cell cycle. The protein encoded by the gene is a DNA endonuclease, which physically cleaves DNA, but only at the 매트 locus (due to the DNA sequence specificity of the HO endonuclease).

Once HO cuts the DNA at 매트, exonucleases are attracted to the cut DNA ends and begin to degrade the DNA on both sides of the cut site. This DNA degradation by exonucleases eliminates the DNA which encoded the 매트 allele however, the resulting gap in the DNA is repaired by copying in the genetic information present at either HML 또는 HMR, filling in a new allele of either the 매트NS 또는 MATα 유전자. Thus, the silenced alleles of 매트NS 그리고 MATα present at HML 그리고 HMR serve as a source of genetic information to repair the HO-induced DNA damage at the active 매트 현장.

Directionality of the mating type switch Edit

The repair of the 매트 locus after cutting by the HO endonuclease almost always results in a mating type switch. 언제 NS cell cuts the 매트NS allele present at the 매트 locus, the cut at 매트 will almost always be repaired by copying the information present at HML. 그 결과 매트 being repaired to the MATα allele, switching the mating type of the cell from NS to α. Similarly, an α cell which has its MATα allele cut by the HO endonuclease will almost always repair the damage using the information present at HMR, copying the 매트NS gene to the 매트 locus and switching the mating type of α cell to NS.

This is the result of the action of a recombination enhancer (RE) [6] located on the left arm of chromosome III. Deletion of this region causes NS cells to incorrectly repair using HMR. 에 NS cells, Mcm1 binds to the RE and promotes recombination of the HML region. In α cells, the α2 factor binds at the RE and establishes a repressive domain over RE such that recombination is unlikely to occur. An innate bias means that the default behaviour is repair from HMR. The exact mechanisms of these interactions are still under investigation.

Ruderfer et al. [7] analyzed the ancestry of natural S. 세레비지애 strains and concluded that matings involving out-crossing occur only about once every 50,000 cell divisions. Thus it appears that, in nature, mating is most often between closely related yeast cells. Mating occurs when haploid cells of opposite mating type 매트NS 그리고 MATα come into contact. Ruderfer et al. [7] pointed out that such contacts are frequent between closely related yeast cells for two reasons. The first is that cells of opposite mating type are present together in the same ascus, the sac that contains the cells directly produced by a single meiosis, and these cells can mate with each other. The second reason is that haploid cells of one mating type, upon cell division, often produce cells of the opposite mating type with which they can mate (see section "Mating type switching", above). The relative rarity in nature of meiotic events that result from out-crossing appears to be inconsistent with the idea that production of genetic variation is the primary selective force maintaining mating capability in this organism. However this finding is consistent with the alternative idea that the primary selective force maintaining mating capability is enhanced recombinational repair of DNA damage during meiosis, [8] since this benefit is realized during each meiosis subsequent to a mating, whether or not out-crossing occurs.

Fission yeast Edit

Schizosaccharomyces pomb is a facultative sexual yeast that can undergo mating when nutrients are limiting. [9] Exposure of 에스 폼베 to hydrogen peroxide, an agent that causes oxidative stress leading to oxidative DNA damage, strongly induces mating, meiosis, and formation of meiotic spores. [10] This finding suggests that meiosis, and particularly meiotic recombination, may be an adaptation for repairing DNA damage. [11] The overall structure of the 매트 locus is similar to that in S. 세레비지애. The mating-type switching system is similar, but has evolved independently. [4]

Self-mating in 크립토코커스 네오포르만스 편집하다

크립토코커스 네오포르만스 is a basidiomycetous fungus that grows as a budding yeast in culture and in an infected host. C. neoformans causes life-threatening meningoencephalitis in immune compromised patients. It undergoes a filamentous transition during the sexual cycle to produce spores, the suspected infectious agent. The vast majority of environmental and clinical isolates of C. neoformans are mating type α. Filaments ordinarily have haploid nuclei, but these can undergo a process of diploidization (perhaps by endoduplication or stimulated nuclear fusion) to form diploid cells termed blastospores. [12] The diploid nuclei of blastospores can then undergo meiosis, including recombination, to form haploid basidiospores that can then be dispersed. [12] This process is referred to as monokaryotic fruiting. Required for this process is a gene designated dmc1, a conserved homologue of genes RecA in bacteria, and RAD51 in eukaryotes. Dmc1 mediates homologous chromosome pairing during meiosis and repair of double-strand breaks in DNA (see Meiosis also Michod et al. [13] ). Linet al. suggested that one benefit of meiosis in C. neoformans could be to promote DNA repair in a DNA damaging environment that could include the defensive responses of the infected host. [12]



코멘트:

  1. Ferrell

    놀랍게도, 그것은 매우 귀중한 작품입니다

  2. Lambert

    우리는 이것을 무한히 조사할 수 있습니다

  3. Dicage

    훌륭하고 유용한 것

  4. Haralambos

    지금 말할 수없는 것은 부끄러운 일입니다 - 나는 일하기 위해 서두르고 있습니다. 그러나 나는 석방 될 것입니다 - 나는이 질문에 대해 생각할 것입니다.



메시지 쓰기