정보

소포 및 비 소포 수송

소포 및 비 소포 수송


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

나는 그것들을 소포로 운반되거나 소포 없이 운반되는 것으로 분류해야 합니다.

내가 생각하는 것 -

  1. 비수포성

2. 수포

3. 수포

4. 수포

5. 비 수포성

6. 수포

7. 수포

8. 수포

9.수포

내 말이 맞아? 소포에 의해 운반되는 단백질이 ER 리보솜에서 만들어진다는 것이 사실입니까? 단백질은 어떻게 비소포성 수송으로 수송되는가?


분비 경로로 들어가는 모든 단백질은 소포 수송을 통해 해당 경로의 특정 지점으로 진행됩니다. 여기에는 리소좀 단백질, 통합 원형질막 단백질 및 분비 단백질(또한 목록에 없지만 ER의 상주 단백질, 골지 단백질, 일부 엔도솜 단백질)이 포함됩니다.

세포골격 단백질은 세포질입니다: 나는 그것이 때때로 '운반된다'고 주장할 수 있다고 생각합니다. 튜불린 트레드밀링, 모터 등이 포함되지만 소포는 포함되지 않습니다. 핵 단백질은 핵공을 통해 세포질에서 핵으로 들어갑니다. 그들은 핵 위치 파악 신호를 가지고 있습니다. 소포는 관여하지 않습니다. 미토콘드리아, 엽록체 및 과산화소체는 모두 고유한 신호와 관련된 자체 단백질 수입 시스템을 가지고 있습니다. 다시 소포가 관여하지 않습니다.


11.6: 소포 수송

  • E. V. Wong 제공
  • Axolotl Academica Publishing(생물학) at Axolotl Academica Publishing

단백질 처리 외에도 ER과 Golgi는 일부 유형의 단백질 수송을 처리합니다. 소포(막에 결합된 기포, 본질적으로)는 ER, 골지체 및 기타 막성 소기관에서 꼬집어 나와 막의 해당 부분에 포함된 분자뿐만 아니라 막힌 유체 내부에 있는 모든 가용성 분자를 운반합니다. 그런 다음 이 소포는 키네신이나 미오신과 같은 분자 모터를 타고 적절한 목적지에 도킹하고 표적 막이나 세포 소기관과 융합할 때까지 세포 골격을 따라 이동합니다. 일반적으로 소포는 ER에서 시스 골지로, 시스에서 내측 골지로, 내측에서 트랜스 골지로, 트랜스 골지에서 원형질막 또는 기타 구획으로 이동합니다. 대부분의 움직임이 이 방향으로 이루어지지만, Golgi에서 ER로 다시 이동하는 소포도 있습니다. 이 소포는 ER(예: PDI)에 있어야 하고 소포 내에서 우연히 퍼진 단백질을 운반합니다.

그림 (PageIndex<16>). 소포는 소포체에서 싹이 트고 합쳐져 ERGIC를 형성하고, 이는 시스 골지, 그 다음 내측 골지, 마지막으로 트랜스 골지로 성숙합니다. 소포는 또한 이러한 다른 구획에서 다른 소기관 또는 원형질막으로 싹이 트일 수 있습니다.

소포의 형성은 적절한 조건에서 구형 케이지로 자가 조립되는 외피 단백질에 의존합니다. 막관통 단백질과 결합하면 부착된 막을 끌어당겨 구형으로 만들 수도 있습니다. 소포 형성에 사용되는 주요 유형의 외피 단백질은 COPII, COPI 및 clathrin입니다.

COPII 외피 단백질은 ER에서 Golgi로 이동하는 소포를 형성합니다. COPI 외피 단백질은 골지체의 일부 사이에 사용되며 골지체에서 다시 ER로 가는 소포를 형성합니다. 마지막으로, 클라트린은 세포내이입을 위해 원형질막으로부터 형성된 소포뿐만 아니라 원형질막을 위한 골지체를 떠나는 소포를 형성하는 데 사용됩니다.

그림 (PageIndex<17>). 클라트린. (A) clathrin은 transmembrane 화물 수용체에 결합된 어댑터 단백질에 결합하여 멤브레인을 clathrin과 연결합니다. (B) 단일 clathrin triskelion은 3개의 중쇄와 3개의 경쇄로 구성됩니다. (c) triskelions는 추가 에너지나 효소가 필요 없이 대략 구형 구조로 자가 조립됩니다.

Clathrin(그림 (PageIndex<17>))은 세 가지 중 가장 잘 설명되어 있으며 수포 코트는 clathrin triskelions(그리스어에서 세 다리를 의미함) 배열로 만들어집니다. 각 triskelion은 C-말단에서 함께 연결된 세 개의 중쇄와 각 중쇄와 연결된 세 개의 경쇄로 구성됩니다. 서로 다른 triskelion의 중쇄는 중쇄 &ldquolegs&rdquo의 길이를 따라 상호 작용하여 매우 견고한 구조를 만듭니다. 경쇄는 소포 형성에 필요하지 않으며 세포질에서 클라트린 분자의 우발적인 상호작용을 방지하는 데 도움이 되는 것으로 생각됩니다.

멤브레인에 ARF1(ARF는 ADP 리보실화 인자를 나타내며, 여기에서 기능과 아무 관련이 없음)의 모집으로 시작하여 이러한 서로 다른 코트 단백질을 사용하는 소포 형성 메커니즘 사이에는 상당한 유사성이 있습니다. 이를 위해서는 ARNO를 통해 GTP를 GDP로 교환해야 합니다(ARNO는 ARF 뉴클레오티드 결합 사이트 오프너임). ARF1이 GTP에 결합되면 구조적 변화는 멤브레인에 삽입되는 N-말단 미리스토일 그룹을 나타냅니다. COPI와 clathrin-coated vesicles는 모두 ARF1과 ARNO를 사용하지만 COPII는 Sar1p와 Sec12p라는 유사한 단백질을 사용합니다.


그림 (PageIndex<18>). COP 코팅된 소포

ARF1(또는 Sar1p)은 막 결합 수용체 단백질의 "꼬리" 말단에 결합하는 어댑터 단백질을 모집하는 데 사용됩니다. 이 수용체의 비즈니스 말단은 소포에 포장되어야 하는 화물 분자에 결합합니다. 어댑터 단백질은 (수용체를 통해) 막과 외피 단백질 사이의 연결 고리 역할을 합니다. clathrin의 경우 어댑터 단백질은 트랜스 골지 유래 소포의 경우 AP1이고 세포내 소포의 경우 AP2입니다. COPI 소포의 경우 대략적인 상동체는 &베타-, &감마-, &델타- 및 &제타-COP인 반면 COPII 시스템은 Sec23p 및 Sec24p를 사용합니다.

마지막으로 어댑터는 실제 외피 단백질인 clathrin, &alpha- 또는 &epsilon-COP, Sec13p 및 Sec31p에 연결됩니다. 이들 단백질이 모두 공통적으로 가지고 있는 것은 자발적으로(즉, 에너지 소비에 대한 요구 없이), 케이지와 같은 구형 구조로 자가 조립된다는 것입니다. 전자현미경에서 clathrin으로 코팅된 소포는 더 선명하게 정의되고 clathrin 소단위로 둘러싸인 육각형 및 오각형 모양은 소포에 "축구공" 모양을 제공합니다. COP 코타머로 코팅된 소포는 EM에서 외관상 훨씬 더 흐릿합니다.

세 가지 유형의 소포 코트 단백질은 모두 자발적으로 구형 구조로 결합하는 능력을 갖지만 COPI 및 COPII 코팅된 소포만이 자발적으로 멤브레인을 "핀치 오프"하여 원래 막에서 소포를 방출합니다. 클라트린으로 코팅된 소포는 소포를 방출하기 위한 외부 메커니즘이 필요합니다(그림 (PageIndex<19>)).

그림 (PageIndex<19>). 각각 GTPase인 다이너민 단량체는 소포의 목 주위에서 중합됩니다. GTP가 가수분해되면 다이너민 &ldquonoose&rdquo가 조여져 소포를 조입니다.

소포가 거의 완성되면 소포를 막에 연결하는 막의 작은 줄기 또는 목이 여전히 있습니다. 이 줄기 주위에 동적 GTP 분자가 고리/나선 구조로 집합합니다. 다이너민 분자는 GTP의 가수분해 시 수축하는 구형 GTPase입니다. 그들이 소포 줄기 주위에 결합할 때, 각 다이너민 단백질은 수축하여 막이 함께 꼬집어질 만큼 줄기를 수축시켜 원래 막에서 소포를 밀봉하고 방출하는 결합된 효과를 나타냅니다.

그림 (PageIndex<20>). 글리세로인지질은 주로 ER에서 만들어집니다. ER이 스핑고지질을 위한 세라마이드 전구체를 만들기도 하지만, 스핑고지질은 골지체에서만 만들어집니다.

지질과 막이 4장에서 논의되었지만 진핵생물에서 지질과 막이 합성되는 위치에 대해서는 논의하지 않았습니다. 그림 (PageIndex<20>)에서 알 수 있듯이 특정 유형의 지질 합성은 분리되고 배타적입니다. 글리세로인지질은 미토콘드리아와 과산화소체에서도 만들어지지만 주로 소포체에서 형성됩니다. 대조적으로, 스핑고지질은 포유류의 ER에서 만들어지지 않지만(세라마이드 전구체는 있음), 필요한 효소는 시스 및 내측 골지의 내강에서 발견됩니다. 이론적으로 지질 유형의 재분배를 나타내는 다양한 Golgi 및 ER 구획 사이의 전향 및 역행 수포 트래픽의 증거가 있습니다. 그러나, 스핑고지질은 지질 뗏목으로 응집되는 경향이 있고 전방으로 이동하는 소포에 더 집중되어 있는 것으로 보입니다.

외피 단백질은 소포 방출 직후에 떨어져 나갑니다. clathrin의 경우 이 과정에는 ATPase인 Hsc70이 포함됩니다. 그러나 COPI 또는 COPII 코팅된 소포의 경우 ARF/Sar1p에서 GTP의 가수분해는 어댑터에 대한 코트 단백질 친화성을 약화시키고 코팅 해제를 시작하는 것으로 보입니다. GTPase 활성화제는 ARF GAP(또는 Sec23p)이며 COP I(또는 II) 코트의 필수적인 부분입니다.

소포는 가용성 단백질과 막횡단 단백질의 두 가지 범주의 화물을 운반합니다. 가용성 단백질 중 일부는 수용체에 결합되어 소포에 흡수됩니다. 다른 단백질은 우연히 근처에 있고 소포가 형성되면서 퍼집니다. 때때로, 예를 들어 PDI가 ER에서 형성되는 소포에 둘러싸일 수 있다고 가정하지 않은 단백질이 흡수됩니다. 골지체에서는 거의 기능을 하지 않고 응급실에서는 필요하므로 어떻게 됩니까? 다행스럽게도 PDI와 다른 많은 ER 단백질은 C-말단 신호 서열인 KDEL(Lysine-Aspartic Acid-Glutamic Acid-Leucine)을 가지고 있으며, 이는 &ldquoI은 ER에 속합니다.&rdquo는 골지체 내부의 KDEL 수용체에 의해 인식되며, 수용체에 대한 KDEL 단백질의 결합은 소포 형성을 유발하여 이들을 다시 ER로 보냅니다.

분비 소포는 용해성 화물에 특별한 문제가 있습니다. 소포가 형성 과정에서 단순히 단백질을 둘러싸는 것에 의존한다면 고농도의 단백질을 얻기 어려울 것입니다. 많은 분비 단백질은 유기체에 의해 신속하고 상당한 양으로 필요하므로 트랜스 골지체에는 분비 단백질을 응집시키는 메커니즘이 있습니다. 이 메커니즘은 큰 농축 과립에서 표적 단백질을 결합하는 세크레토그라닌 II 및 크로모그라닌 B와 같은 응집 단백질을 사용합니다. 이 그래닌은 낮은 pH와 높은 Ca 2+의 트랜스 골지 환경에서 가장 잘 작동하므로 소포가 세포 외부로 내용물을 방출할 때 높은 pH와 낮은 Ca 2+는 응집체를 분해하여 개별 단백질을 방출합니다.

Golgi의 성숙 동안 일관된 pH 변화가 있으므로 ER에서 Golgi로 이동함에 따라 각 구획은 점진적으로 더 낮은(더 산성인) 내강 pH를 갖습니다.

마지막으로 소포를 표적화하는 문제가 있습니다. 소포는 분자 화물 열차에 던져져 무작위로 떨어지면 훨씬 덜 유용합니다. 따라서 소포의 세포질 표면에 있는 v-SNARE 단백질과 표적막의 세포질 표면에 있는 t-SNARE의 매칭을 필요로 하는 도킹 메커니즘이 있습니다. 소포와 막의 융합은 일치하는 경우에만 진행됩니다. 그렇지 않으면 소포가 융합할 수 없으며 다른 분자 모터에 부착되어 다른 올바른 목적지로 향하게 됩니다. 이 과정은 처음에 들어오는 소포와 접촉하고 SNARE 단백질 상호작용을 테스트하기 위해 표적에 충분히 가깝게 끌어당기는 테더링 단백질의 도움을 받습니다. 그런 다음 소포와 표적 막의 다른 단백질이 상호작용하고 SNARE가 일치하면 소포를 표적 막으로 &ldquowinch&rdquo하는 데 도움이 될 수 있으며, 그 결과 막이 융합됩니다. 소포 융합과 막 단백질 및 지질의 방향성을 이해하는 데 있어 중요한 경험 법칙은 막의 세포질 쪽이 항상 세포질을 향하게 된다는 것입니다. 따라서 결국 세포막의 외부 표면에서 발견되는 단백질은 처음부터 ER 막의 내강 표면에 삽입되었을 것입니다.

그림 (PageIndex<21>). 소포는 먼저 테더링 단백질(A)과 상호작용하여 소포와 표적 막을 가깝게 만드는 데 도움이 됩니다. 그런 다음 SNARE는 상호 작용할 수 있으며 일치하면 서로 비틀기 시작하여 비틀림에 따라 두 막을 더 가깝게 맞춥니다.

보다 구체적으로, 소포가 표적막에 접근함에 따라 이중 geranylgeranyl 지질 꼬리를 통해 표적막에 연결된 테더링 단백질 Rab-GTP는 소포와 느슨하게 결합하고 표적막 부근에 유지하여 일할 기회를 잡습니다. v-SNARE 및 t-SNARE는 이제 상호 작용하고 일치 여부를 테스트할 수 있습니다. 최근에 SNARE는 보존된 아르기닌 및 글루타민 잔기를 기반으로 각각 R-SNARE 및 Q-SNARE로 이름이 변경되었습니다. 이 두 가지 기본 SNARE 외에도 적어도 하나의 다른 SNARE가 관련되어 함께 4개의 α-나선 묶음을 형성합니다(최소한 가장 잘 연구된 예에서 SNARE 중 하나가 구부러져 2개가 되도록 α-나선 영역 중 4개가 상호작용에 참여하며, 4개의 나선이 서로를 감싸면서 소포와 표적막을 함께 끌어당기는 것으로 생각됩니다.

파상풍 독소, 파상풍 파스민은 다음에서 방출됩니다. 클로스트리디움 테타니 박테리아, 신경 세포에 작용하여 경련을 일으키고 신경 전달 물질 방출을 방지합니다. 그 메커니즘은 SNARE 단백질인 시냅토브레빈을 절단하여 시냅스 소포가 세포막과 융합할 수 없도록 하는 것입니다. 보툴리눔 톡신, 클로스트리디움 보툴리눔, 또한 SNARE에 작용하여 소포 융합 및 신경 전달 물질 방출을 방지하지만 다른 뉴런을 표적으로 하므로 반대 효과가 있습니다. 파상풍은 억제성 신경 전달 물질의 방출을 방지하여 발생하는 반면 보툴리누스 중독은 흥분성 신경 전달 물질의 방출을 방지하여 발생합니다.


수포 및 비소포 수송은 골지체에서 뚜렷한 글리코실화 경로를 제공합니다.

새로 합성된 단백질과 지질은 각각의 역할이 완전히 명확하지 않은 다른 메커니즘을 통해 골지 복합체를 가로질러 수송됩니다. 우리는 이전에 세포질 GlcCer-전달 단백질 FAPP2(PLEKHA8로도 알려짐)에 의해 작동되는 글루코실세라마이드(GlcCer)에 대한 비소포성 골지 수송 경로를 확인했습니다. ). 그러나 cis-Golgi에서 trans-Golgi 네트워크로의 FAPP2 매개 GlcCer 전달의 분자적 결정인자와 GlcCer의 두 가지 평행한 수송 경로(소포 및 비소포)를 골지체, 제대로 정의되지 않은 상태로 남아 있습니다. 여기에서 마우스 및 세포 모델을 사용하여 FAPP2에 의한 GlcCer의 골지 내 벡터 전달의 기초가 되는 분자 메커니즘을 명확히 하고 GlcCer가 골지 수조 및 트랜스에서 위상학적으로 구별되는 두 개의 글리코실화 트랙으로 소포 및 비소포 수송에 의해 전달됨을 보여줍니다. -골지망, 각각. 우리의 결과는 골지 복합체를 가로지르는 수송 양식이 화물의 글리코실화 패턴에 대한 핵심 결정인자이며 글리코스핑고지질 합성 경로의 분기에 대한 새로운 패러다임을 확립함을 나타냅니다.


소포 및 비소포 수송 - 생물학

형광(A.U.) 100 200 300 0 100 200 300

mm당 개수 0 500 1,000 0 500 1,000

mm당 카운트 0 500 1,000 0 500 1,000

그림 1 | FAPP2는 생체내 글로보사이드 수준을 선택적으로 조절합니다. a, 척추동물에서 GSL 합성 경로의 단순화된 표현. GA2S, GA2 합성효소 GCS, GlcCer 합성효소 LC3S, LC3 합성효소. b, 마우스 조직에서 FAPP2의 발현. c, 야생형(FAPP21/1) 및 재조합(FAPP2geo/1 및 FAPP2geo/geo) 마우스 꼬리 DNA의 서던 블롯. 보충 그림 1b를 참조하십시오. d, FAPP21/1 및 FAPP22/2 고환 및 신장에서의 FAPP2 수준. e, 인지질(PL) 및 스핑고지질(SL) 질량 분석 및 FAPP21/1(n 5 5)로부터의 신장의 GSL 측정 및

er eb er rum eb el lumm Live Spr le e Sm K n al idn lI nt ey es tin e Test 는

GlcCer LCS Asialo 시리즈 GA2S GA2 GA1 LacCer Gb3S GM3S LC3S

2 | 현재 상태 | 볼륨 0 0 0 | 0 0 월 2 0 1 3

©2013 Macmillan Publishers Limited. 판권 소유

그림 2 | FAPP2는 Gb3 합성에 선택적으로 필요합니다. a, HeLa 세포의 GSL 수준. KD, 녹다운 X, 할당되지 않은 음이온 GSL. b, 3H-스핑고신 표지된 HeLa 세포의 고성능 박층 크로마토그래피(HPTLC) 프로파일. 화살표는 FAPP2 녹다운에 의해 유도된 변화를 나타냅니다. 숫자는 총 스핑고리피드에 대한 각 GSL 종의 백분율을 나타냅니다. c, C12-BODIPY-GlcCer 표지된 HeLa 세포의 HPTLC 프로파일. 화살표는 FAPP2 녹다운에 의해 감소된 GSL을 나타내고 #은 할당되지 않은 피크를 나타내고 숫자는 총 GSL에 대한 각 GSL 종의 백분율을 나타냅니다. A.U., 임의의 단위. d, GSL 종에 대한 FAPP2 및 GSL 합성 효소의 침묵 효과(총 GSL의 백분율로 표시됨). 숫자는 총 스핑고리피드에 대한 총 GSL의 백분율을 나타냅니다. 6s.d.를 의미합니다. 최소 3번의 독립적인 실험. *P , 0.05 **P , 0.01.

글로보사이드 합성을 위한 구획. 이 가설은 몇 가지 주요 예측을 생성했습니다. (1) LCS는 골지 수조뿐만 아니라 TGN에도 존재해야 합니다. (2) Gb3와 유사하게 TGN에서 만들어지는 다른 LacCer 파생물은 FAPP2에 의존해야 합니다. Golgi cisternae에서 TGN으로 GM3S의 위치를 ​​이동하면 GM3 합성이 FAPP2 고갈에 민감해집니다. 우리는 이 모든 예측을 검증했습니다. 첫째, LCS는 골지 수조와 TGN(보충 그림 8) 모두에 국한되는 것으로 나타났습니다. 둘째, SK-N-MC 인간 신경 세포의 FAPP2 녹다운은 LacCer의 TGN(그림 1a 및 보충 그림 9a) 세 번째, 일반적으로 둔감한 GM3 합성은 GM3S의 상당 부분이 효소를 높은 수준으로 발현하여 TGN에 국한될 때 FAPP2 고갈에 민감해집니다(보충 그림 9b-d). TGN에서 합성된 GSL에 대한 FAPP2의 선택적 요구는 FAPP2가 고갈된 세포가 TGN1에서 GlcCer를 집중시키는 데 실패한다는 우리의 이전 관찰과 함께 FAPP2가 GlcCer가 합성되는 cis-Golgi에서 GlcCer의 전달을 유도한다는 것을 나타냅니다. TGN, 그리고 이 벡터 전송이 어떻게 지속되는지에 대한 질문을 제기합니다. 우리는 cisGolgi에서 TGN으로의 전이를 매개하기 위해 apo-FAPP2가 초기 Golgi 막을 표적화해야 하는 반면 GlcCer-bound FAPP2는 TGN을 표적화해야 한다고 추론했습니다. 따라서 우리는 야생형 FAPP2의 분포를 GlcCer에 결합할 수 없어 영구적으로 apo인 FAPP2 돌연변이체(FAPP2(W407A))1의 분포와 비교했습니다. 야생형 FAPP2의 주요 부분은 TGN에 국한되지만 FAPP2(W407A)의 주요 부분은 골지 수조에 국한됩니다(그림 4a, b). 또한, 야생형 FAPP2는 TGN에 국한되지 않고 주로 골지 수조에 존재했습니다.

*** 20 40 60 80 100 120 GSL 합성(% 대조군)

그림 3 | 수포성 GlcCer 수송은 골지 수조에서 GM3 합성을 공급하는 반면, 비수포성 GlcCer 수송은 TGN에서 Gb3 합성을 공급합니다.a–c, Gb3 및 GM3 합성에 대한 BFA(5 mg ml21)의 효과(a). 면역형광(b)과 면역전자현미경(c)에 의해 평가된 HA-Gb3S 및 HA-GM3S의 분포. b에서 상단 패널은 처리되지 않은 세포를 나타내고 하단 패널은 노코다졸 처리된 세포(3시간, 33mM)를 나타냅니다. 삽입: 박스 영역의 확대. HA-Gb3S 및 HA-GM3S와 TGN46의 공동 국소화는 각각 50% 및 14%였습니다. 데이터는 조건당 최소 30개의 셀을 나타냅니다.

내인성 Gb3S의 주요 분획(GM3S가 아님)이 TGN에 존재하므로 BFA 유도 혼합 ER-Golgi 구획에서 합성되는 기질과 분리된 상태로 남아 있음을 나타내는 GM3의 것은 아닙니다(그림 3a). 둘째, GM3S와 Gb3S의 분포를 분석하였다(Fig. 3b, c). 이전 보고서 6,15와 일치하여 우리는 Gb3S가 TGN에 풍부하고 GM3S가 골지 수조에 풍부하다는 것을 발견했습니다. 또한 BFA는 GSL 합성에 대한 영향(그림 3a)과 일치하여 GM3S를 ER에 재배포했지만 Gb3S는 재배포하지 않았습니다(보충 그림 6). FAPP2의 역할 분석은 GM3과 같이 FAPP2 고갈에 둔감한 더 복잡한 강글리오사이드를 합성하는 다른 세포주로 확장되었습니다(보충 그림 7). 따라서, TGN에서 글로보사이드의 합성은 FAPP2에 의해 작동되는 GlcCer의 비소포성 수송에 의존하는 반면, 골지 수조에서의 GM3 합성은 그렇지 않아 GM3 합성이 대신 GlcCer의 소포 수송에 의존하는지 여부에 대한 질문을 이끌어냅니다. 이 문제를 해결하기 위해 우리는 세포를 dicoumarol1로 처리하거나 TRAPP 구성 요소 BET3(TRAPPC3이라고도 함)(참조 1)을 고갈시키거나 세포질 포스포리파제 A2(cPLA2)를 고갈(참조 16)하여 골지 내 막 트래피킹1을 억제했습니다. 수포성 구내염 바이러스 G 단백질(ts045-VSVG)14의 온도에 민감한 돌연변이체의 수송을 따랐습니다. 이전에 보고된 바와 같이 1,16 이러한 처리는 VSVG의 골지 내 진행을 억제하고 GM3 합성을 강력하게 억제했지만 Gb3 합성은 억제하지 않았습니다(그림 3d, e). 이러한 결과는 GlcCer의 소포 수송이 Golgi cisternae에서 만들어지고 GM3 생합성에 사용되는 LacCer 풀을 공급하는 반면 FAPP2를 통한 GlcCer의 비-소포 수송은 LacCer 풀을 공급한다는 것을 제안하게 했습니다. TGN 및 여기에 사용

스케일 바, 10mm. c, 화살표는 TGN에서 클라트린 코팅된 프로파일을 나타냅니다. 데이터는 최소 30개의 스택을 나타냅니다. 스케일 바, 100 nm. d, e, VSVG 전송(시점당 최소 100개 세포에 대한 3개의 독립적인 실험에서 6sd를 의미) 및 GM3 및 Gb3 합성(3시간 3H-스핑고신 펄스)에 대한 골지 내 인신매매 차단 효과( 이자형). 6s.d.를 의미합니다. 세 가지 독립적인 실험 중 DIC, 디쿠마롤(200mM) GC, 골지 복합체 PM, 원형질막. *P , 0.05 **P , 0.01 ***P , 0.005.

0 0 월 2 0 1 3 | 볼륨 0 0 0 | 현재 상태 | 삼

©2013 Macmillan Publishers Limited. 판권 소유

라벨링 분포(전체의 %)

–0 .6 –0 .4 –0 .2 0. 0 0. 2 0. 4 0. 6

FAPP2(W407A) TGN = 37.34 ± 4.65%

스택 중앙으로부터의 거리(μm)

GM130 TGN46 FAPP2-WT FAPP2(W407A)

표면 플라즈몬 공명(응답 단위)

+ GlcCer – GlcCer + GlcCer – GlcCer

덜 노출 더 많이 노출

PtdIns4P Cer LacCer FAPP2 GlcCer Gb3 ARF1

그림 4 | GlcCer 결합은 PtdIns4P에 대한 FAPP2의 결합을 향상시키고 이를 TGN에 표적화합니다. a, 노코다졸 처리된 세포(3시간, 33mM)에서 야생형 FAPP2(FAPP2WT) 및 FAPP2(W407A)의 골지 내 분포. 오른쪽, cis-Golgi-to-TGN 축을 따른 FAPP2의 최대 형광 강도 분포 및 박스 영역 확대(흰색 화살표). 스케일 바, 10mm. b, 야생형 FAPP2 및 FAPP2(W407A)의 최대 표지 분포의 정량화. 스택의 중간(0, 검은색 점선)은 조건당 50개의 스택에서 GM130 및 TGN46 형광 강도 피크로부터 등거리 평면으로 취합니다. c, Meb4 및 GlcCer-결핍 GM95 마우스 세포에서 야생형 FAPP2 및 FAPP2(W407A)의 골지 내 분포. TGN 라벨링의 백분율이 표시됩니다. 오후 6시를 의미합니다. 조건당 최소 30개의 스택. 화살촉은 골지 수조 염색을 나타내고, 쐐기는 TGN 염색을 나타내고, 화살표는 클라트린 코팅 프로파일을 나타냅니다. 스케일 바, 100 nm. d, FAPP2 결합에 대한 GlcCer의 효과에 대한 표면 플라즈몬 공명 분석

1-팔미토일, 2-올레오일 포스파티딜콜린(POPC)-PtdIns4P(98:2 mol:mol) 리포솜으로. 결과는 최소 3개의 독립적인 실험을 나타냅니다. PtdIns4P Kd 값: apo-FAPP2의 경우 24 ± 0.9mM 및 GlcCerbound FAPP2의 경우 6 ± 0.4mM. e, HDX-MS에서 서로 다른 접근성을 나타내는 FAPP2의 영역이 FAPP2에 매핑되었습니다. FAPP2 도메인은 FAPP1 PH 도메인18 및 GLTPH 도메인1,20에서 모델링되었습니다. f, HDX-MS(주황색 화살표) 및 제어된 단백질 분해-MS(파란색 화살표)에 의해 평가된 FAPP2에 대한 GlcCer 로딩에 의해 유도된 형태 변화의 도식적 표현. 자세한 결과는 보충 그림 12 및 13에 나와 있습니다. g, GlcCer의 골지 내 비소포성(빨간색 화살표) 및 소포성(파란색 화살표) 수송의 도식적 표현. 삽입: FAPP2 매개 GlcCertransfer 방향성 메커니즘(청록색 프로필, TGN 빨간색 프로필, 골지 수조 빨간색 화살표, 골지 수조 청록색 화살표에 대한 apo-FAPP2의 표적화, TGN에 대한 GlcCer-결합 FAPP2의 표적화).

FAPP2가 항상 apo인 GlcCer17을 합성하지 않는 세포에서(그림 4c). 이러한 결과는 GlcCer 결합이 TGN에 대한 FAPP2의 표적화를 긍정적으로 조절함을 시사하였다. TGN에서의 FAPP2 위치는 작은 GTPase ARF1과 TGN19가 풍부한 포스포이노시티드인 포스파티딜이노시톨 4-포스페이트(PtdIns4P)14에 동시에 독립적으로18 결합하는 플렉스트린 상동성(PH) 도메인에 의해 결정됩니다. PtdIns4P14 또는 ARF 결합 부위 18(보충 그림 10)의 단일 점 돌연변이는 골지 복합체(참조 14 및 데이터는 표시되지 않음)에 대한 PH 도메인 모집을 폐지하여 두 결합 부위에 대한 요구 사항을 나타냅니다. 그러나 흥미롭게도 이러한 돌연변이가 탠덤 형태의 FAPP PH 도메인(di-PH)에 도입되어 di-PH가 ARF(di-PH-R18L) 또는 Ptdins4P(di- PHE50A), 키메라 단백질은 골지 내 분포가 상당히 다르지만 골지 복합체에 국한될 수 있습니다. 특히, PtdIns4P에 대한 친화도가 낮고 ARF1(di-PH-R18L)에 대한 친화도가 높은 돌연변이 FAPP-PH 도메인은 골지 스택 전체에 분포하는 반면, ARF1에 대한 친화도가 낮고 ARF1이 더 높은 돌연변이 FAPP-PH 도메인 PtdIns4P(di-PH-E50A)18에 대한 친화성은 우선적으로 TGN에 국한되어(보충 그림 10b), 이는 PtdIns4P가 FAPP2의 TGN 표적화를 지시함을 나타냅니다. 따라서 우리는 GlcCer-bound FAPP2의 우선적인 TGN 연관이 PtdIns4P에 대한 친화력이 더 높다는 사실 때문일 수 있는지 여부를 평가했습니다. 우리는 실제로 GlcCer 로딩(보충 정보 및 보충 그림 11)이

PtdIns4P(그림 4d)는 시험관 내에서 ARF1에 결합하는 능력에 유의한 영향을 미치지 않는 반면(표시되지 않음). FAPP2가 카르복시 말단 GLTP 상동성(GLTPH) 도메인1,20을 통해 GlcCer에 결합하고 아미노 말단 PH 도메인14을 통해 PtdIns4P에 결합함에 따라, GlcCer 결합에 의해 유도된 PtdIns4P 친화도의 증가는 GlcCer 결합이 구조적 변화를 촉발한다는 것을 시사했습니다. GLTPH 도메인이지만 더 많은 N-말단 영역으로 전송됩니다. 이러한 구조적 변화에 대한 통찰력을 얻기 위해 우리는 수소-중수소 교환 질량 분석법(HDX-MS)으로 FAPP2를 조사했습니다. FAPP2의 HDX-MS의 일반적인 프로필은 PH-도메인과 GLTPH 도메인에 해당하는 용매에 거의 접근할 수 없는 N-말단 및 C-말단 영역의 존재와 매우 접근 가능하고 유연한 개재 링커 영역의 존재를 나타냅니다. 그림 4e). 그런 다음 우리는 FAPP2의 HDX-MS 프로파일에 대한 GlcCer 결합의 효과를 분석하고 이 분석을 FAPP2의 제어된 단백질 분해의 분석과 통합했습니다. 이러한 분석 결과(그림 4f 및 보충 그림 12 및 13)는 GlcCer의 결합이 FAPP2의 GLTPH 도메인의 안정화를 유도할 뿐만 아니라 GLTPH 도메인과 PH 도메인 사이에 개재된 링커 영역에도 영향을 미치는 것으로 나타났으며, PH 도메인 자체에 영향을 미치므로 PtdIns4P 결합에 영향을 미칠 수 있습니다. 이 시점에서 'FAPP2 주기'를 설명할 수 있습니다(그림 4g). apo-FAPP2는 GlcCer를 획득하는 cis-Golgi와 연결되어 PtdIns4P에 대한 FAPP2의 친화도가 더 높아집니다. 그런 다음 FAPP2는 PtdIns4P가 풍부한 TGN으로 재배치되어 GlcCer를 제공합니다.

4 | 현재 상태 | 볼륨 0 0 0 | 0 0 월 2 0 1 3

©2013 Macmillan Publishers Limited. 판권 소유

LETTER RESEARCH 우리의 연구 결과는 두 개의 가지가 두 개의 평행한 수송 경로(그림 4g)에서 공통 전구체인 GlcCer를 받는 GSL 생합성의 새로운 패러다임을 확립합니다. , FAPP2에 의해 매개되는 비-소포 경로는 개재 수조를 우회하고 GlcCer를 TGN으로 전달하지만 loco에서 변환된 LacCer의 TGN 풀을 globo- 또는 asialo-시리즈의 GSL로 공급합니다(그림 1a 및 4g). 더 넓은 맥락에서, 우리의 결과는 골지 복합체를 통해 화물을 운송하는 다양한 모드가 화물 자체를 뚜렷하고 잠재적으로 경쟁적인 글리코실화 경로로 어떻게 보내는지를 보여줍니다.

방법 요약 FAPP22/2 마우스는 보충 데이터 및 ref. 22. 고성능 액체 크로마토그래피 기반 GSL 측정, 3H-스핑고신을 사용한 대사 라벨링, GSL 추출 및 HPTLC 및 분석, 세포하 단백질 국소화 평가를 위한 면역형광 및 면역전자 현미경 연구는 참고 문헌에 설명된 대로 수행되었습니다. 1. ts045-VSVG의 수송은 이전에 설명한 대로 평가되었습니다23. 단백질 정제, 형광, 원형 이색성 및 표면 플라즈몬 공명 연구는 참고 문헌 24, 25에 설명된 대로 수행되었습니다. HDX-MS는 참고 문헌에서와 같이 수행되었습니다. 26. 통계 분석을 위해 양측 스튜던트 t-검정을 데이터에 적용했습니다. *P , 0.05 **P , 0.01 ***P , 0.005. 전체 방법 및 관련 참고 문헌은 온라인 버전의 논문에서 사용할 수 있습니다. 2012년 6월 21일 접수 2013년 6월 25일 접수. 온라인 게시 2013년 8월 4일. 1. 2. 3. 4. 5. 6. 7. 8.

D'Angelo, G. et al. Glycosphingolipid 합성에는 glucosylceramide의 FAPP2 전달이 필요합니다. Nature 449, 62–67(2007). Hakomori, S. I. glycosphingolipids와 sphingolipids의 구조와 기능: 회상과 미래 경향. 바이오킴. 생물 물리학. Acta 1780, 325–346(2008). Jeckel, D., Karrenbauer, A., Burger, K. N., van Meer, G. & Wieland, F. Glucosylceramide는 다양한 골지체 분획의 세포질 표면에서 합성됩니다. J. Cell Biol. 117, 259–267(1992). Futerman, A. H. & Pagano, R. E. 쥐 간에서 글루코실세라마이드 합성의 세포내 부위 및 토폴로지 결정. 바이오켐. J. 280, 295–302(1991). Hannun, Y. A. & Obeid, L. M. 생리 활성 지질 신호의 원리: 스핑고지질의 교훈. 네이처 목사 Mol. 세포 바이오. 9, 139–150 (2008). Halter, D. et al. 글리코스핑고지질 합성에서 글루코실세라마이드의 골지 전위 전후. J. Cell Biol. 179, 101–115(2007). Maccioni, H. J., Quiroga, R. & Ferrari, M. L. glycosphingolipid glycosylation의 세포 및 분자 생물학. J. Neurochem. 117, 589–602(2011). Jacewicz, M., Clausen, H., Nudelman, E., Donohue-Rolfe, A. & Keusch, G. T. shigella 설사의 병인. XI. 토끼 공장과 HeLa 세포에서 shigella 독소 결합 당지질의 분리 및 globotriaosylceramide로의 식별. J. 특급 메드. 163, 1391-1404(1986). van Heyningen, S. V. 콜레라 독소: 소단위와 강글리오사이드 GM1의 상호작용. 과학 183, 656–657(1974). Psotka, M.A. et al. 시가 독소 2는 쥐의 신장 집합관 상피를 표적으로 합니다. 감염. 면역. 77, 959–969(2009). Okuda, T. et al. Gb3/CD77 합성효소 유전자의 표적 파괴는 글로보 시리즈 글리코스핑고지질의 완전한 결실과 베로톡신에 대한 감수성의 상실을 초래했습니다. J. Biol. 화학 281, 10230–10235(2006). D'Angelo, G., Vicinanza, M. & De Matteis, M.A. 생합성 경로의 지질 전달 단백질. 커. 의견. 세포 바이오. 20, 360–370(2008). Chege, N. W. & Pfeffer, S. R. Golgi 복합체의 구획: brefeldin-A는 trans-Golgi 수조를 trans-Golgi 네트워크와 구별합니다. J. Cell Biol. 111, 893–899(1990).

0 0 월 2 0 1 3 | 볼륨 0 0 0 | 현재 상태 | 5

©2013 Macmillan Publishers Limited. 판권 소유

연구 편지 방법 시약 및 항체. 모든 화학 시약은 분석 등급 이상이었고 달리 명시되지 않는 한 Sigma에서 구입했습니다. 세포 배양 배지는 Invitrogen에서 구입했습니다. 인간 FAPP2, BET3, cPLA2IVa 및 GM130에 대한 폴리클로날 항체는 글루타티온 S-트랜스퍼라제 융합 단백질을 면역원으로 사용하여 토끼에서 생성되었습니다. 모두 해당 면역원에 대해 친화성 정제되었습니다. 항-VSVG 클론 P5D4, 항-Flag M2 및 항-HA 단일클론 항체, 및 항-토끼 및 항-마우스 IgG Cy3-접합된 항체는 Sigma로부터 입수하였다. Alexa 488-conjugated ChTxB 단편은 Invitrogen에서 가져온 것입니다. Cy3-접합된 ShTxB 단편은 설명된 대로 준비되었습니다. GM3에 대한 마우스 단일클론 항체(클론 2590)는 Cosmo Bio Co.에서 제공했습니다. TGN46에 대한 양 다중클론 항체는 AbD Serotech에서 제공했습니다. Alexa 488 염소 항-마우스 및 항-토끼 IgG 항체는 Molecular Probes에서 제공했습니다. 라벨이 없는 모든 정제된 지질은 Avanti Polar Lipids에서 가져왔습니다. 3H-스핑고신은 PerkinElmer에서 구입했습니다. GSL의 스톡 용액은 클로로포름/메탄올(부피 기준 2:1) 및 기타 지질의 헥산/2-프로판올(부피 기준 3:2)에서 준비했습니다. 지질 용액을 220 uC의 암실에 보관하고 사용하기 전에 실온으로 가온했습니다. FAPP2 녹아웃 마우스. 마우스는 C57BL/6 계통에서 유래했습니다. 모든 동물 절차는 군마대학교 동물관리 및 실험위원회의 지침에 따라 수행되었으며 모든 동물은 군마대학교 동물체험연구소에서 사육되었습니다. FAPP2 녹아웃 마우스는 보충 정보에 설명된 절차에 따라 생성되었습니다. 조직학, 면역형광 현미경 및 X-gal 염색은 이전에 설명한 대로 수행되었습니다22,28,29. 세포 배양. HeLa, Meb4, GM95, HepG2, HK2, COS7 및 MDCK 세포를 ref. 1. 33HA-GM3S 코딩 플라스미드의 형질감염 및 G418(Invitrogen) 존재하의 선별 및 간접 면역형광에 의한 단일 클론 콜로니 스크리닝 후에 안정적으로 발현되는 HeLa-GM3S 세포를 얻었다. 플라스미드 및 구조물. 이 연구에 사용된 대부분의 구성물은 RT-PCR과 적절한 벡터로의 클로닝을 통해 HeLa RNA에서 얻었습니다. 간단히 말해서, HeLa 세포에서 전체 RNA를 분리했습니다. RT-PCR은 폴리 dT 올리고를 프라이머로 사용하여 수행되었습니다. 얻어진 상보적 DNA는 다음 프라이머를 사용하여 PCR을 위한 주형으로 사용되었습니다: Gb3S의 경우: 정방향 59-GTTGAATTCGATCTGG GGATACCATGTCC-39, 역방향 59-CACCTCGAGCAAGTACATTTTCATGG CCTC-39 GM3S의 경우 AAATTAGATCAGCGCAGCAAATTATCATTCAGAATGCATGAAGGCC9 LCS용 CTCCA-39: 정방향 59-ATAGAATTCTGGCTGCAGCATGCGCGC39, 역방향 59-CGCGATATCAAGTACTCGTTCACCTGAGCCA-39. PCR 산물을 선형화된 pCR2.1 벡터에 클로닝하고 자동 시퀀싱을 위해 처리했습니다. 복제된 모든 서열은 인간 Gb3S(AF513325), GM3S(AY152815.2) 및 LCS(B4GALT5(NM_004776))에 대한 데이터베이스에 보고된 서열과 일치했습니다. 그런 다음 다양한 코딩 서열에 해당하는 DNA를 C-말단의 pCDNA3-3XHA 또는 p3XFLAG-CMV-14의 EcoRI/XhoI(Gb3S), EcoRI/NotI(GM3S), EcoRI/EcoRV 부위에 서브클로닝했습니다. 녹색 형광 단백질(GFP)-FAPP2 야생형 및 W407A 구조는 참고 문헌에 설명된 대로 얻었습니다. 1 재조합 GST-FAPP2 야생형, GST-FAPP2(W407A), His-FAPP2 야생형 및 His-FAPP2(W407A)는 ref. 1.

GFP-diFAPP2PH-야생형 및 E50A는 다음과 같이 얻었습니다: GFP-FAPP2 야생형 DNA는 프라이머로 사용하는 두 가지 별개의 PCR 반응에 대한 주형으로 사용되었습니다. PCR(a): 59-TCTGAATTCATGGAGGGGGTGCTGTACA-3, 59-TAT GGTACCGAGCAAGCAAGCCTTGGCTGATCCC 3 PCR(b): 59-TATGGT ACCTTGCTGGAGGGGGTGCTGTACAAGTG-3, 59-TCACTCGAGTTAGCA AGCCTTGGCTGATCC-3. PCR(a)의 생성물을 벡터 pEGFP-C1의 EcoRI/KpnI 부위에 서브클로닝하여 구축물 pEGFP-FAPP2PH를 얻었다. 그 후, PCR(b)의 생성물을 pEGFP-FAPP2PH 구성체의 KpnI/XhoI 부위에 서브클로닝하여 GFP-diFAPP2PH-야생형을 얻었다. GFP-FAPP2(E50A) DNA를 주형으로 사용하여 GFP-diFAPP2PH(E50A) 돌연변이체를 얻기 위해 유사한 절차를 적용했습니다. GFP-FAPP2(E50A)는 프라이머 59GAGCATACAAATGGCAGTCTGTGCAATTCAAGTTCATTCTGTAG-39 및 59-CTACAGAATGAACTTGAATTGCACAGACTGCCATTTGTATGCTC-39를 사용하여 부위 지정 돌연변이 유발에 의해 야생형 GFP-FAPP2에서 얻었습니다. siRNA 처리. 인간 FAPP2(NM_001197026), GCS(NM_003358), BET3(NM_014408), B4GALT5(NM_004776), B4GALT6(NM_004775), SIAT9/GM3S(AY420)_16(NM_004775), SIAT9/GM3S(AY125)_1GS에 대한 siRNA로 구성됨 최소 3개의 siRNA 이중체의 혼합물(보충 표 1)은 Dharmacon에서 얻었습니다. HeLa, HK2, HepG2 및 MDCK 세포를 12웰 플레이트에 30% 합류로 플레이팅하고 제조업체의 프로토콜에 따라 Oligofectamine(Invitrogen) 또는 Dharmafect4(Dharmacon)가 포함된 120-150pmol의 siRNA로 형질감염되었습니다. siRNA로 초기 처리 후 72시간에 세포를 직접 처리하였다. 침묵 효율은 웨스턴 블롯(보충 그림 2) 또는 특정 프라이머(보충 표 1)를 사용하는 정량적 PCR(보충 그림 4b)에 의해 평가되었습니다. GSL 측정. 3H-스핑고신 또는 14C-갈락토스를 사용한 대사 라벨링, GSL 추출 및 HPTLC 및 분석은 참고 문헌 1, 6에 설명된 대로 수행되었습니다. 면역형광 및 형태측정 분석. 모든 면역형광 실험은 이전에 설명한 대로 수행되었습니다1,14. 이미지는 LSM 710(Zeiss) 공초점 현미경을 사용하여 얻은 공초점 광학 조각입니다. 공동 위치 분석은 ref. 14 또는 ImageJ30용 JACoP v2.0 애플리케이션에 포함된 객체 기반 colocalization 방법을 사용합니다. 간단히 말해서, 노코다졸 처리된 세포의 개별 미니 스택은 분할 후 질량 중심 위치가 계산된 개체로 간주되었습니다. 단일 미니 스택에서 두 개의 서로 다른 라벨링(즉, Gb3S/TGN46 또는 GM3S/ TGN46)에 대한 질량 중심 위치의 완벽한 일치는 긍정적인 공동 지역화 이벤트로 간주되었습니다. 면역전자현미경. 면역 전자 현미경 검사는 이전에 설명한대로 형질 감염된 HeLa, Meb4 및 GM95 세포에서 수행되었습니다. VSVG 세포내 수송 분석. ts045-VSVG의 수송은 이전에 설명한 대로 평가되었습니다23. 통계 분석. 통계 분석을 위해 양측 스튜던트 t-검정이 데이터에 적용되었습니다. *P , 0.05 **P , 0.01 ***P , 0.005. 27. 28. 29. 30.

Mallard, F. & Johannes, L. Shiga 독소 B-소단위는 역행 수송을 연구하는 도구입니다. 방법 Mol. 메드. 73, 209–220(2003). Muramatsu, K. et al.쥐의 타우 유전자좌에 삽입된 Cre 재조합효소에 의한 뉴런 특이적 재조합. 바이오켐. 생물 물리학. 해상도 통신 370, 419–423(2008). Hashimoto, Y. et al. 마우스에서 Cre 재조합효소에 의한 뉴런 특이적 및 유도성 재조합. Neuroreport 19, 621–624 (2008). Bolte, S. & Cordelieres, F. P. 광학 현미경에서 세포내 colocalization 분석에 대한 가이드 투어. J. Microsc. 224, 213–232(2006).


소포 트래피킹과 지질 수송을 동기화하는 PI4P

기욤 드린

진핵 세포의 놀라운 특징은 내부 소기관에 비해 가장 바깥쪽 막인 원형질막(PM)에 특수 지질인 스테롤이 풍부하다는 것입니다. 스테롤은 소포체(ER)에서 지질의 단지 1-5%, 골지 복합체에서 더 많고 PM에서 최대 40%를 나타냅니다[34]. 그러한 축적은 중요합니다. 단단한 구조로 인해 스테롤은 인접 지질의 유연성을 감소시켜 PM을 두껍고 불투과성으로 만듭니다. 그러나 대부분의 스테롤은 ER에서 합성되거나 지질 방울에서 비축되기 때문에 ER에서 유래합니다. 따라서 ER에서 PM으로 스테롤을 운반하는 데 전념하는 메커니즘이 세포에서 관찰되는 스테롤 구배를 생성하는 데 작용한다는 것이 분명해 보였습니다. 초기 연구에 따르면 스테롤은 실제로 ER에서 PM으로 이동하지만 분비 경로를 통해 순환하는 수송 소포와는 별개로 이동합니다. 특히 효모에서 핵심 단백질인 Sec18을 억제하여 거의 모든 소포 경로를 차단하는 것은 직접적인 ER-to-PM 스테롤 전달에 영향을 미치지 않는 것으로 밝혀졌습니다[35]. 따라서 스테롤은 이 매우 소수성인 분자가 소기관 사이의 물 '벽'을 가로지르는 것을 도울 수 있는 지질 전달 단백질(LTP)에 의해 주로 비소포 경로를 따라 전달된다는 것이 제안되었습니다.

우리 중 일부는 이 전송이 어떻게 발생하는지 더 잘 설명하고 싶었습니다. 흥미로운 모델은 PM에서 거의 독점적으로 발견되는 지질 부류인 스핑고지질의 부족이 스테롤 축적을 방해한다는 것을 보여주는 관찰에서 나왔습니다. 스테롤은 스핑고지질에 대해 우선적인 친화력을 가지고 있으며 아마도 ER을 희생시키면서 PM에 갇혀 있을 것입니다. 따라서 추가 조사 없이 PM의 열역학적 트랩에 의해 뒷받침되는 ER과 PM 사이에서 무작위로 스테롤을 이동할 수 있는 LTP가 두 막 사이에 스테롤 구배를 생성한다는 것이 제안되었습니다. 우리의 경우, 우리는 효모의 스테롤 운반체로 제안된 Osh/ORP 계열의 단백질인 Osh4/Kes1에 대해 새로운 시각을 밝혔습니다. 흥미로운 사실을 발견했습니다. Osh4는 스테롤을 포스파티딜이노시톨 4-포스페이트(PI4P)라고 하는 두 번째 지질과 교환할 수 있습니다[7]. PI4P는 trans-Golgi와 PM에서 에너지 의존적 방식으로 만들어지며 이 영역에서 두드러지는 반면 가수분해 반응은 ER에 축적되는 것을 방지합니다. 이것은 매력적인 아이디어로 이어졌습니다. PI4P의 이러한 불균형은 Osh4가 스테롤을 ER에서 trans-Golgi 또는 PM으로 운반하는 데 사용할 수 있습니다. 확산에 의해 세포질을 통해 이동하는 한 주기에서 Osh4는 ER에서 스테롤 분자를 추출하고 Golgi 막에서 PI4P와 교환한 다음 ER에 PI4P를 침착시킵니다. 시험관 내에서 Osh4는 PI4P 구배를 소산시켜 두 막 사이에서 벡터 방식으로 스테롤을 수송하고 그 대가로 스테롤 구배를 생성할 수 있습니다[36]. 따라서 Osh4는 세포에서 스테롤 구배를 생성하기 위해 PI4P 회전율을 활용하는 완벽한 분자 장치인 것 같습니다. 그러나 우리가 직면한 문제는 시험관 내에서 측정된 스테롤의 수송이 실제로 세포에서 일어나고 있는지 여부입니다. 실제로 7개의 Osh 단백질 중 어느 것도 효모의 ER-PM 경계면에서 측정된 큰 스테롤 플럭스를 보장할 수 있는 LTP가 아닌 것으로 보입니다[37]. 보다 최근에 우리는 구조적 및 기능적 분석에서 많은 것들이 스테롤에 결합할 수 없다는 것을 배웠습니다([38]에서 검토). Osh4와 관련하여, 언뜻 보기에는 지질 수송 기능과 연결하기 어려운 역할인 극성화된 엑소사이토시스(polarized exocytosis)에서 조절 역할의 증거로 인해 논쟁이 더욱 복잡해졌습니다.

Polarized exocytosis는 trans-Golgi에서 PM으로 단백질을 운반하는 소포에 의존합니다(그림 2). 부모 구획에서 분리되면 이 소포는 액틴 케이블을 따라 이동하고 PM에 도킹하고 융합을 통해 내용물을 전달합니다. 이러한 사건은 초기 소포 표면의 PI4P에 결합하는 단백질에 의해 시작되지만 도킹 과정을 허용하려면 PI4P가 나중에 사라져야 합니다[40]. 신진 과정 자체는 신비하고 트랜스 골지체에서 발생하는 지질 의존적 리모델링 과정에 의존합니다. 가설은 스테롤과 스핑고지질을 정렬된 도메인으로 공동 분리하는 것이 포스트 골지 소포의 발아에 중요하다는 것입니다. 흥미롭게도 스테롤은 trans-Golgi에서 지질의 10%를 차지하며 exocytic vesicles에서는 두 배 이상을 차지합니다. 사실, 많은 관찰에 따르면 이러한 소포의 수명 주기는 Osh4의 지질 교환 활성에 직접적으로 의존합니다. 실제로, Osh4는 트랜스 골지체에서 PI4P의 가용성을 감소시키고 세포의 PI4P 수준을 낮춥니다[42]. 이것은 Osh4가 PI4P를 소비하여 트랜스 골지에 스테롤을 공급하여 스핑고지질 및 결국 소포 생성과의 적절한 연관을 허용함을 시사합니다. 흥미롭게도, Osh4는 트랜스 골지 막을 통해 주로 포스파티딜세린(PS)을 대체하는 플립파제인 Drs2와 조정합니다. 막에서 발생하는 비대칭은 또한 세포외액 배출에 필수적인 신진 과정을 촉진합니다[43]. Osh4는 아마도 PI4P를 제거함으로써 Drs2를 억제하고, 그 대가로 Drs2에 의한 PS의 노출은 Osh4에 의한 스테롤 전달을 억제할 수 있습니다[44]. 포스트 골지 수준에서 Osh4는 PM으로 가는 도중에 외세포 소포에서 PI4P를 제거하여 도킹에 적합하게 만듭니다[45]. 따라서 도킹 ​​단계 전에 Osh4가 마지막 남은 PI4P 분자와의 교환을 통해 스테롤로 새로 형성된 소포의 농축을 완료한다고 가정할 수 있습니다. 따라서 유력한 아이디어는 Osh4가 교환 능력을 사용하여 골지횡단막의 리모델링과 골지 이후 인신매매 동안 중요한 역할을 한다는 것입니다. 이것은 Osh4의 부재가 PM의 스테롤 분포에 영향을 미치는 이유를 설명합니다[37].

Exocytic vesicles의 budding은 아마도 sterol과 sphingolipids의 microdomain으로의 결합과 Drs2에 의해 촉매되는 PS의 flip-flop에 달려 있습니다. 스테롤/PI4P 교환에 의해 Osh4는 트랜스 골지에 스테롤(ER에서 제조)을 공급하고 PI4P를 제거합니다(그런 다음 ER로 다시 운반되어 가수분해됨). 스테롤 가져오기는 PI4P 제거를 통해 Osh4에 의해 억제되는 Drs2의 플립파제 활성과 조정될 수 있습니다. trans-Golgi의 세포질 측에서 PS의 노출은 차례로 Osh4를 하향조절할 수 있습니다. 방출되면 소포는 융합 전에 PM에 도킹됩니다. 소포 형성을 촉진하는 Rab 단백질인 Ypt32도 도킹 프로세스로 이어지는 일련의 이벤트를 시작합니다. PI4P와 관련된 Ypt32의 GTP 결합 형태는 Sec2를 모집합니다. 그런 다음 Sec2는 Rab Sec4p를 활성화하여 엑소시스트 서브유닛인 Sec15를 모집합니다. Osh4는 PI4P를 추출하고 PI4P의 부족은 Sec15에 대한 열의를 얻는 Sec2의 구조적 변화를 유발합니다. Sec2-Sec4-Sec15 복합체의 형성은 소포를 도킹에 적합하게 만듭니다. 동시에 Osh4는 교환 활동으로 인해 스테롤의 소포 농축을 강화할 가능성이 있습니다. 이러한 모든 요소는 Osh4가 소포의 스테롤 축적을 수명 주기의 주요 단계와 동기화하여 확장 동안 PM의 적절한 지질 구성 및 조직을 보장함을 시사합니다.

이 시나리오에서 나온 것은 Osh4에 의한 지질 교환을 위한 연료이자 PI4P 표적 이펙터에 의해 인식되는 분자 신호인 PI4P가 스테롤 농축을 동기화할 수 있고 따라서 세포 외유출을 위한 다른 중요한 이벤트와 막 성숙을 동기화할 수 있다는 것입니다. 따라서 효모에서 PI4P는 비소포성 지질 수송 과정과 소포성 수송 사이의 기능적 노드로 명확하게 나타납니다. 이러한 데이터는 또한 스테롤 분획이 수송 소포에 의해 PM으로 선택적으로 전달될 수 있다는 점을 재고하도록 합니다. 그것의 풍부함과 지질 교환율을 감안할 때, 엑소사이토시스와 결합된 Osh4 작용은 효모의 비대칭 분열 동안 PM 표면의 확장에 필요한 스테롤의 최대 60%를 제공할 수 있습니다[36]. Osh4가 없을 때 분비 소포의 스테롤 함량을 분석하는 것이 좋습니다. 보다 일반적으로, LTP에 의해 매개되는 ER-to-Golgi 스테롤 수송 및 세포 스테롤 구배 생성에 대한 기여를 추적하는 접근 방식을 개선하는 것이 좋습니다.

PI4P 대사에 의해 촉진되는 지질 교환은 진핵생물에서 점점 더 광범위한 메커니즘으로 나타납니다. 인간에서 sterol-PI4P 교환은 Osh4 동족체인 OSBP에 의해 매개되는 ER-Golgi 접촉 부위에서 발생합니다[9]. OSBP는 더 복잡하며 교환 효율성을 위해 PI4P 결합 도메인을 통해 트랜스 골지에 고정되어야 합니다. 스테롤 수송을 위해 PI4P를 소비하기 때문에 OSBP는 접촉 부위에서의 체류 시간과 스핑고리피드 전구체를 수송하는 PI4P 결합 단백질 CERT도 조절할 수 있습니다[9]. 여기에서 PI4P는 트랜스 골지체에서 스테롤과 스핑고지질의 공동 농축을 직접 조정하는 역할을 할 수 있습니다. 최근에 우리와 다른 사람들은 Osh6/Osh7과 인간의 가장 가까운 상동체인 ORP5/ORP8이 PS/PI4P 교환기임을 확인했습니다[6, 10]. 이제 우리는 PI4P 대사가 PM에서 ER 유래 PS의 축적을 유도한다는 것을 이해합니다.와이 신호 단백질의 분자 표지 및 활성제로서의 역할. 이러한 새로운 교환 경로가 다른 PI4P 종속 메커니즘과 조정되고 막 리모델링 과정과 관련되는지 여부를 정의하는 것은 향후 흥미로운 연구의 문제가 되어야 합니다.


HDL은 주로 콜레스테롤 제거제로서 기능하여 담즙산으로의 전환을 위해 간으로 콜레스테롤의 수송을 촉진하고 장간 담즙산 순환에서 제거 또는 재활용을 위해 담즙으로의 분비를 촉진합니다. 콜레스테롤 제거의 주요 기능 때문에 HDL은 일반적으로 죽상동맥경화증을 예방하는 것으로 간주됩니다. 세포로부터 콜레스테롤은 배설을 위해 간으로 콜레스테롤을 운반하는 세포외 수용체로서 특히 apoA-I 및 HDL로 유출에 의해 제거될 수 있습니다. 이 과정을 역 콜레스테롤 수송이라고 합니다. 이러한 맥락에서 ATP 결합 카세트 수송체 단백질 ABCA1은 apoA-I 함유 HDL 전구체로의 세포 콜레스테롤 및 인지질 방출을 촉진합니다. 또한 ABCA1은 HDL 입자 형성에 필요한 소포성 지질 수송 메커니즘에서 역할을 합니다. 일반적으로 세포내 지질 항상성을 유지하기 위해 스테롤 및 관련 지질은 소포 및 비소포 경로에 의해 세포 구획 사이를 이동합니다. 그러나 소포 형성에 대한 콜레스테롤 분류는 잘 이해되지 않습니다. 이 리뷰는 HDL의 분자 메커니즘 및 세포 지질 항상성을 매개하는 관련 소포 인신 매매 메커니즘에 대한 현재 지식을 요약합니다.

HDL의 가장 두드러진 역할은 과도한 콜레스테롤이 담즙 배설을 통해 제거되거나 장-간 주기에서 재사용하기 위해 말초 세포에서 간으로 셔틀되는 역 콜레스테롤 수송 과정에서의 역할입니다. 특히 ABC-수송체 및 인지질 전달 단백질을 통한 대식세포로부터의 콜레스테롤 흡수는 동맥경화증의 발병기전의 첫 번째 단계 중 하나인 동맥경화성 병변에서 거품 세포의 형성을 방지합니다. HDL은 주로 지질 대사에 관여하는 아포지단백질 apoA-I, AII, AIV, E, CI에서 CIV, LI, M, F, D 및 H에 대한 보관소 역할을 합니다. ApoA-I 함유 HDL 입자는 항동맥경화성이며 역 콜레스테롤 수송을 통해 동맥경화를 방지하고 항염증 및 항혈전 반응에 중요한 역할을 합니다. 1 따라서, 치료적 HDL 상승은 죽상동맥경화증의 치료를 위한 새로운 길을 열 수 있습니다. 1

스캐빈저 수용체 클래스 B 유형 I(SR-BI)은 HDL에 대한 수용체로, HDL 입자로부터 콜레스테롤 및 콜레스테릴 에스테르의 수송을 매개합니다. 이것은 주로 간 및 비태반 스테로이드 생성 조직에서 발현되며 HDL로부터 콜레스테릴 에스테르의 선택적 흡수에 관여합니다. 2 SR-BI 기능은 혈관벽의 콜레스테롤 유출에도 중요합니다. 2

HDL에 의해 흡수된 유리 콜레스테롤은 레시틴:콜레스테롤 아실트랜스퍼라제(LCAT)에 의해 에스테르화되고 소수성 콜레스테릴 에스테르는 HDL의 코어에 유지되어 새로운 콜레스테롤 분자가 HDL 표면에서 전위될 수 있습니다.

과량의 유리 콜레스테롤은 세포질 지질 방울에 저장하기 위해 올레오일-CoA로 콜레스테롤을 에스테르화하는 ER에 국한된 스테롤 o-아실트랜스퍼라제 1(SOAT1)에 의해 에스테르화됩니다. 콜레스테릴에스테르의 재가수분해는 중성 콜레스테릴에스테르 가수분해효소(카르복실에스테라제-1, 단핵구/대식세포 세린 에스테라제-1, CES1)를 통해 일어날 수 있습니다. 유리 콜레스테롤 각각 에스테르화되지 않은 콜레스테롤/인지질 복합체는 ATP-결합 카세트 수송체(ABC) ABCA1 및 ABCG1을 통해 유출됩니다. HDL로의 콜레스테롤 유출에는 ABCG1이 필요하지만 apoA-I로의 유출에는 ABCA1이 필요합니다. 3 ABCA1에 의해 매개되는 과정에서 세포 인지질과 에스테르화되지 않은 콜레스테롤의 바람직한 세포외 수용체는 apoA-I의 단분자, preβ-migration, 지질이 부족하거나 지질이 없는 형태입니다. 이 단핵 형태의 apoA-I는 입자당 2 또는 3개의 apoA-I 분자를 포함하고 인간 혈장에서 HDL 분획의 미량 성분으로 존재하는 β-이동 전 원판형 HDL과 상당히 구별됩니다. 4 ABCG1은 콜레스테롤 외에도 스핑고미엘린과 포스파티딜콜린의 유출을 매개하며, ABCG1이 매개하는 콜레스테롤 유출은 스핑고미엘린에 의존적임을 시사했습니다. 5 결과적으로 ABCG1 발현은 상염색체 열성 장애인 탕헤르병 환자의 대식세포에서 상향조절되며, 상염색체 열성 장애는 ABCA1 돌연변이, 혈장 HDL의 거의 완전한 부재, 세망내피계의 콜레스테릴 에스테르 침착, 세포의 이상을 특징으로 합니다. 지질 밀매.

콜레스테롤의 합성 및 흡수는 ER에서 골지 복합체로 막 결합 전사 인자 스테롤 조절 요소 결합 단백질 2(SREBP2)의 스테롤 게이트 수송에 의해 매개되는 피드백 메커니즘을 통해 조절됩니다. 대조적으로, SREBP-1c는 주로 지방산과 인지질 합성에 관여합니다. 흥미롭게도 ABCG1 발현은 SREBP-1c 의존적 메커니즘에 의해 유도될 수 있습니다. 6

PPARα 및 PPARγ는 RXR/LXR과 이종이량체를 형성함으로써 피브레이트의 지질 저하 작용 및 티아졸리딘디온의 항당뇨 효과를 매개합니다. 7 LXR은 콜레스테롤 유출 경로에 관여하는 표적 유전자의 전사를 지시하고 대식세포의 염증 유전자를 억제합니다. 그들은 지방 생성과 콜레스테롤 항상성을 조절하고 세포에서 HDL로 콜레스테롤 유출을 자극합니다. 8 징크 핑거 전사 인자 ZNF202는 ABCA1 및 ABCG1을 포함한 역 콜레스테롤 수송에 관여하는 유전자를 억제하므로 HDL, 트리글리세리드 및 포도당 대사의 상호 연결에서 중심 역할을 합니다. 7 ABCA1과 카제인 키나제, AMP 키나제 및 Janus 키나제의 상호작용에서 파생된 신호 캐스케이드가 지질 대사 조절에 관여합니다(그림 2).

또한 콜레스테롤 트래피킹은 소포 수송에 의해 조절되며, 이 리뷰는 HDL의 분자 메커니즘 및 세포 지질 항상성을 매개하는 관련 소포 트래피킹 메커니즘에 대한 현재 지식을 요약합니다.

지질 수송 단백질에 의해 조절되는 콜레스테롤 밀매

지질 전달/지질다당류 결합 단백질 유전자군에는 살균 투과성 증가 단백질(BPI), 지질다당류 결합 단백질(LBP), 인지질 전달 단백질(PLTP) 및 콜레스테릴 에스테르 전달 단백질(CETP)이 포함되어 전신 염증으로부터 보호하고 지질을 촉진합니다. 옮기다. 9 CETP는 콜레스테롤이 HDL에서 트리글리세리드가 풍부한 지단백질로, LDL로, 트리글리세리드가 트리글리세리드가 풍부한 지단백질에서 HDL로 전달됩니다. 9 CETP는 콜레스테롤 에스테르가 HDL에서 LDL로 옮겨지고 LDL 수용체 매개 흡수를 통해 간에서 흡수되는 역 콜레스테롤 수송에서 콜레스테롤 플럭스의 촉진제입니다. 9 성숙한 HDL의 혈장 수준과 HDL 입자의 크기를 조절합니다. 9 PLTP는 HDL 리모델링 및 지질 불량 apoA-1 입자 형성에 중요한 역할을 하는 잔여 지단백질로부터 인지질을 전달함으로써 HDL 수준을 조절합니다. 9 PLTP에 의한 지질 유출의 강화는 PLTP와 apoA-I의 ABCA-1 결합을 통한 ABCA-1 경로를 포함합니다. 9 PLTP는 또한 혈장 preβ-HDL 수준을 증가시켜 간접적으로 세포 콜레스테롤 유출을 촉진할 수 있습니다. 9 인슐린 저항성 피험자의 혈장은 더 높은 PLTP 활성과 증가된 preβ-HDL 형성으로 인해 더 낮은 HDL 콜레스테롤 수치에도 불구하고 콜레스테롤 유출에 대한 정상적인 용량을 나타냈습니다. 9

옥시스테롤 결합 단백질 관련 단백질(ORP)은 가용성 스테롤 수송체로도 기능합니다. 10 인간 게놈에는 12개의 OSBP(옥시스테롤 결합 단백질)/ORP 계열 구성원 유전자가 포함되어 있으며, 이는 세포에서 지질 합성 및 지질 수송을 직접 제어하는 ​​데 관여합니다. 10 ORP1S는 대부분 세포질인 반면, ORP1L은 엔도솜 트래피킹에 관여하고 후기 엔도솜 구획에 국한됩니다.

내강 콜레스테릴 에스테르에서 산 리파제에 의해 방출된 유리 콜레스테롤은 후기 엔도솜 밖으로 콜레스테롤 수송을 위해 NPC2(HE1)에 의해 내강 막 관련 NPC1로 전달됩니다. 단백질 StarD3(MLN64)를 포함하는 스테로이드성 급성 조절 단백질(StAR) 관련 지질 전달(START) 도메인은 엔도솜에서 방출된 콜레스테롤에 결합하고 엔도솜 막에서 수용체 막으로의 표적 특이적 스테롤 전달을 매개하는 지질 수송 단백질로 기능할 수 있습니다. 10 엔돌리소좀 지질 저장 질환 Niemann Pick Type C(NPC)는 NPC1 및 NPC2 유전자의 돌연변이로 인해 후기 세포내 세포 소기관에 콜레스테롤 및 기타 지질이 축적됩니다.

소포 수송에 의해 규제되는 콜레스테롤 밀매

세포는 ER에서 가장 낮은 농도와 원형질막에서 가장 높은 농도로 분비 시스템 전반에 걸쳐 콜레스테롤 구배를 유지합니다. 원형질막에서 콜레스테롤의 높은 농도를 유지하기 위해 콜레스테롤은 원형질막을 표적으로 하는 소포로 분류될 수 있습니다. 스테롤이 수송 소포에서 어떻게 능동적으로 분류되거나 배제되는지는 거의 알려져 있지 않습니다. 스핑고미엘린과 콜레스테롤은 COPI 코팅된 소포에서 부분적으로 제외되며, 이는 골지 네트워크에서 ER 및 골지 내 수송으로의 역행 수송에 중요한 것으로 나타났습니다. 10,11 콜레스테롤 및 기타 지질의 분류는 콜레스테롤 및 스핑고지질이 풍부한 마이크로도메인에 대한 친화성과 막 곡률의 영향에 의해 주도될 수 있습니다. 10,11

골지 복합체 분해를 유발하는 브레펠딘 A로 세포를 처리하면 역행 수송을 촉진하고 ER에서 원형질막으로의 단백질 이동을 차단하지만 새로 합성된 콜레스테롤이 원형질막으로 전달되는 데에는 미미한 영향을 미치므로 콜레스테롤이 골지체를 우회할 수 있음을 나타냅니다 원형질막으로 진행하는 장치. 10 그러나 세제 저항성 막을 포함하는 세포 표면으로 새로 합성된 콜레스테롤을 수송하는 데 골지 복합체가 부분적으로 기여한다는 증거도 있습니다. 12

엔도솜은 다양한 양의 콜레스테롤을 함유하고 있으며, 수송 소포 형성 동안 콜레스테롤이 분류되는 endocytic 및 분비 경로의 구획 사이에 연속적인 소포막 수송이 있습니다. 13 산 리파제 결핍(콜레스테릴 에스테르 저장 질환[CESD]/Wolman Disease), NPA/B(산 스핑고미엘리나제 결핍증), NPC와 같은 엔도리소좀 저장 장애, 후기 엔도솜에서 콜레스테롤 축적을 유발하는 특정 양친매성 화합물(인지질증)을 설명하는 데 도움이 되었습니다. endocytic lipid trafficking에 대한 콜레스테롤 축적의 병리학 적 효과. NPC 단백질은 NPC1 및 NPC2와 같은 소포 인신 매매의 조절에 직접 관여하거나 손상된 세포 소기관 역학은 콜레스테롤 축적의 결과입니다. 13 포스포글리세레이트로부터 합성된 인지질인 리소비스포스파티딘산(LBPA)은 후기 엔도솜에서만 검출 가능합니다. LBPA는 LBPA와 상호작용하는 단백질 Alix/AlP1의 제어하에 엔도솜 콜레스테롤 수치를 조절하여 콜레스테롤을 다포성 엔도솜으로 분류합니다. 14 LBPA는 NPC 세포에서 병리학적 콜레스테롤 축적을 제한하고 외인성 LBPA의 추가는 NPC 표현형을 부분적으로 되돌립니다. 14 이것은 LBPA가 엔도솜 콜레스테롤 함량을 조절함을 나타냅니다.

Rab GTPase의 가장 큰 서브패밀리인 Rab 단백질은 막 트래픽에 대한 구획 특이성을 제공하는 소포 트래피킹의 주요 조절자입니다. 15,16 Rab 의존성 막 수송은 후기 세포내 세포 소기관에서 콜레스테롤을 제거하는 데 관여합니다. Rab-guanine nucleotide dissociation inhibitor(GDI)를 사용한 기능의 교란은 후기 엔도솜에서 콜레스테롤 제거를 손상시키는 것으로 나타났습니다. 13 막 콜레스테롤 로딩은 GDI에 의한 막에서 Rab4, Rab5, Rab7 및 Rab9를 포함한 여러 Rab의 추출성을 손상시킵니다. 17

Rab9 또는 Rab7의 과발현은 후기 엔도좀/리소좀에서 콜레스테롤 축적을 감소시키는 것으로 보고되었습니다. 18,19 Rab9가 NPC 표현형을 보완하는 반면, Rab7 과발현은 한 연구에서는 유사하게 작용하지만 다른 연구에서는 그렇지 않습니다. 18,19 ORP1L은 포유동물 세포에서 GTP-GDP 순환을 조절함으로써 Rab7을 통한 엔도솜 트래피킹에 영향을 미치는 것으로 보입니다. 20 Rab8은 Golgi 영역, 소포 구조 및 말초 막 주름에 국한되며 엔도솜을 중간체로 재활용하는 것과 관련된 세포 표면으로의 극성 막 교통에서 기능합니다. 17 인간 섬유아세포의 Rab8은 후기 엔도솜 구획에서 apoA-I로 콜레스테롤 전달을 조절하고 Rab8의 과발현에 의해 자극됩니다. 17 Rab8은 콜레스테롤 에스테르화를 증가시키지 않으면서 후기 엔도솜에서 세포 주변부로 콜레스테롤을 재분배하고 ABCA1-리간드 apoA-I로 콜레스테롤 유출을 자극합니다. 17

후기 엔도좀 외에도 엔도좀 재활용 경로는 스테롤 수송에 참여합니다. 엔도솜 재활용은 비소포성 메커니즘에 의해 콜레스테롤을 획득할 수 있지만 21 세포 표면으로의 스테롤 재활용은 Rab11 및 Rme-1과 같은 다른 재활용 화물의 소포 수송을 매개하는 동일한 분자에 의해 조절되는 것으로 보입니다. 13

ABCA1 매개 콜레스테롤 유출 및 수포 밀매

apoA-I, apoE 및 preβ-HDL-전구체를 포함한 지질이 없는 아포지단백질은 ABCA1이 콜레스테롤 및 인지질의 전달을 촉진하는 세포외 유리 콜레스테롤 수용체이며, 이 과정은 소포 수송도 포함합니다. 원형질막의 또 다른 apoA-I 고친화성 결합 부위는 ATP 합성에 관여하는 원형질막에도 존재하는 미토콘드리아 내막의 주요 단백질 복합체인 인간 ATP 합성효소의 β-사슬이었다. 22 그것은 2개의 주요 도메인인 F0과 F1이며, 후자는 5개의 다른 서브유닛을 포함하며, 그 중 β-사슬이 apoA-I와 상호작용합니다. 또한 ATP 합성효소의 β-사슬과 α-사슬 모두 원형질막에서 apoE가 풍부한 HDL에 대한 수용체인 것으로 보고되었습니다. 23 ABCA1과 함께 지질 유입/유출 가변 저항기에서 F0/F1-ATPase의 관련 가능성은 그림 1에 나와 있습니다.

그림 1. 지질 유입/유출 가변 저항기 모델은 균형에서 지질 흡수 및 내보내기 메커니즘을 유지합니다. ATP 합성효소는 apoA-I 또는 apoE에 의해 조절되어 ATP에서 ADP로의 전환이 향상됩니다. apoA-I가 없으면 액틴이 ATP에 결합하고 중합하여 II형 식균 작용에 필수적인 F-액틴을 형성할 수 있기 때문에 식균 작용에서 침강이 증가합니다. 따라서 apoA-I는 유입을 증가시킬 수 있습니다. 반면, apoA-I는 ABCA1에 결합하여 지질 유출을 증가시킵니다. 이 평형의 기능 장애는 세포 지질 트래픽의 심각한 장애로 이어질 수 있습니다. 이것은 ABCA1이 작동하지 않고 apoA-I 의존성 콜레스테롤이 없는 탕헤르병 환자에서 분명합니다. 그러나 콜레스테롤 유입은 ATP 합성효소 B의 apoA-I 의존적 자극에 의해 강화되어 콜레스테롤 에스테르 형성 및 강화된 거품 세포 형성으로 이어집니다.

ABCA1의 일부는 후기 엔도솜에서 콜레스테롤 유출을 촉진할 수 있는 내부 세포내이입 구획에 위치합니다. 24 ABCA1의 내재화 및 트래피킹은 세포 내 콜레스테롤 풀에서 콜레스테롤 유출을 매개하는 데 기능적으로 중요합니다. 24 세포 표면 지질의 고갈은 트랜스-골지 네트워크를 통해 원형질막으로 후기 엔도솜/리소좀에서 지질을 동원하기 위한 신호 캐스케이드를 유도합니다. 이 과정은 NPC1에 의해 촉진되고 NPC1 돌연변이에 결함이 있습니다. 결과적으로 ABCA1 매개 유출도 손상되어 HDL 콜레스테롤 수치가 감소합니다. 24 ABCA1은 아마도 일부 apoA-I를 함유할 수 있는 후기 엔도솜을 포함하는 세포내 구획과 원형질막 사이에서 빠르게 재순환되며, 이 과정은 또한 HDL 생성을 위해 세포 표면으로 지질의 전달을 유지합니다. 24 ADP-리보실화 인자(ARF)는 소포 출아 단계에서 분비 및 엔도솜 경로에서 소포 수송을 제어하는 ​​Ras 관련 작은 조절 GTPase를 나타냅니다. ARF 유사 7(ARL7)은 트랜스 골지 네트워크와 원형질막 사이의 수송에 관여하며 ABCA1과 함께 트랜스 골지 구획에서 콜레스테롤 및 인지질 함유 소포의 방출을 촉진합니다. 25

apoA-I의 Retroendocytosis는 endosome과 lysosome에서 콜레스테롤의 ABCA1 관련 방출에 관여할 수 있습니다. 24 또한, apoA-I/ABCA1 매개 콜레스테롤 유출에 대한 반응으로 골지에서 원형질막으로의 강화된 소포 수송은 ABCA1 결핍 섬유아세포에서 결핍되어 트랜스-골지 지질 저장을 유도합니다. 24

소포 수송에서 중요한 역할을 하는 SNARE 단백질인 Syntaxin 13은 ABCA1 및 flotillin-1 27과 연관됩니다(그림 2). Syntaxin 13 결핍은 ABCA1 매개 콜린 인지질 유출을 감소시킵니다. 26 ABCA1은 또한 ABCA1 결핍으로 인해 식세포 작용이 강화되기 때문에 식균 조절에 역할을 합니다. 26

그림 2. ABCA1의 상호 작용 단백질과 그 세포 기능이 표시됩니다. ApoA-I는 ABCA1의 2개 세포외 도메인과 상호작용하여 인지질/콜레스테롤 유출을 활성화합니다. Syntaxin 13과 β2-syntrophin은 텍스트에서 설명한 것처럼 소포 수송에 관여합니다.

소포 교통에 관여하는 Rho 계열 GTPase Cdc42는 ABCA1과 직접 상호작용하고 필로포디아 형성, 액틴 조직, 세포내 지질 수송 및 ABCA1 의존성 지질 유출을 제어합니다. 27-29 ABCA1은 세포내 소포에 존재하는 것으로 밝혀졌으며, 30 이러한 소포의 이동은 β2-신트로핀/유트로핀을 통해 ABCA1이 세포골격에 결합함으로써 방해될 수 있습니다(그림 2).

해면체 처리의 구조적 및 기능적 이상과 기능적 ABCA1이 결여된 세포의 골지체 분비 경로는 골지체와 원형질막 사이의 소포 출아를 포함하는 지질 내보내기 과정이 심각하게 방해를 받는다는 것을 나타냅니다. 요약하면, 원형질막으로의 콜레스테롤 수송은 세포내 풀에서 원형질막, 트랜스-골지막 및 재활용 엔도솜에 위치한 ABCA1으로 콜레스테롤 플럭스를 매개하는 표적 특이적 소포 수송 시스템에 의존합니다.

결론 및 전망

ApoA-I/HDL 의존성 소포성 지질 수송 기계는 수송체(예: ABCA1/ABCG1, NPC1), 수송 ATPase(예: ATP-합성효소), 소포성 단백질(HE-1, Rabs 등) 및 지질 전달 단백질을 포함합니다. 지질 축적 질환 치료의 잠재적 표적이 될 수 있습니다. 또한, 단백질 키나제 A(PKA), 야누스 키나제 2(JAK2) 및 카제인 키나제와 관련된 신호 전달 캐스케이드가 ABCA1 기능을 조절합니다. 이러한 HDL 경로 구성 요소 간의 기능적 관계를 밝히고 세포 지질 항상성을 촉진하는 새로운 약물 표적을 식별하기 위해서는 더 자세한 조사가 필요합니다.

2009년 3월 15일에 접수됨 2009년 6월 15일에 수락된 개정판.

자금 출처

이 검토에서 인용된 저자의 작업은 DFG 프로젝트 SFB-TR 13, EU 프로젝트 SSA Lipidomics(ELIFE) Proposal-Nr의 지원을 받았습니다. 013032 및 Lipidomic Net Proposal-Nr. 202272.


수포 및 비소포 수송은 골지체에서 뚜렷한 글리코실화 경로를 제공합니다.

새로 합성된 단백질과 지질은 각각의 역할이 완전히 명확하지 않은 다른 메커니즘을 통해 골지 복합체를 가로질러 수송됩니다. 우리는 이전에 세포질 GlcCer-전달 단백질 FAPP2(PLEKHA8이라고도 함)에 의해 분리되는 글루코실세라마이드(GlcCer)에 대한 비소포성 골지 수송 경로를 확인했습니다. 그러나 cis-Golgi에서 trans-Golgi 네트워크로의 FAPP2 매개 GlcCer 전달의 분자적 결정인자와 GlcCer의 두 가지 평행한 수송 경로(수포성 및 비소포성)를 골지체를 통해 유지하는 생리학적 관련성, 잘 정의되지 않은 상태로 남아 있습니다. 여기에서 마우스 및 세포 모델을 사용하여 FAPP2에 의한 GlcCer의 골지 내 벡터 전달의 기초가 되는 분자 메커니즘을 명확히 하고 GlcCer가 Golgi cis ternae 및 각각 trans-Golgi 네트워크. 우리의 결과는 골지 복합체를 가로지르는 수송 양식이 화물의 글리코실화 패턴에 대한 핵심 결정인자이며 글리코스핑고지질 합성 경로의 분기에 대한 새로운 패러다임을 확립함을 나타냅니다.


미세소관 제어 세포 분극에서 비소포성 지질 수송의 필수 역할

세포 분극은 기본적인 생물학적 과정입니다. 분열 효모는 미세소관 제어 세포 분극의 분자 기반을 연구하는 핵심 모델 시스템입니다. 이 과정에서, 세포는 드 노보 합성 스테롤. 미세소관은 세포 극에 인자를 침착시켜 이러한 영역의 수와 위치를 제한합니다. 이러한 스테롤이 풍부한 막 도메인 형성 및 분극의 기본 메커니즘은 크게 알려져 있지 않습니다. 우리는 옥시스테롤 결합 단백질 kes1p, osh2p 및 kes3p가 원형질막에 대한 3개의 독립적인 스테롤 전달 경로를 정의한다는 것을 발견했습니다. 이들은 포스포이노시티드 의존적 방식으로 세포 분극의 다른 단계를 매개하고 소포 인신매매 단계에 대한 요구 사항이 다릅니다. 중복, kes1p 및 osh2p 종속 경로는 무작위로 분포된 스테롤이 풍부한 원형질막 도메인의 형성을 매개함으로써 중요하고 주요 세포 분극입니다. 이러한 도메인의 후속 미세소관 제어 분극은 cdc42p와 무관하게 원형질막에 스테롤을 직접 전달하는 kes1p를 우선적으로 사용합니다. kes1p가 결핍된 세포에서 분극은 주로 kes3p 의존성 경로를 이용하여 cdc42p 의존성이 됩니다. 우리의 연구는 비소포성 지질 수송을 위한 필수적인 생물학적 기능을 밝히고 cdc42p-독립 및 cdc42p-의존 세포 분극에 작용하는 다양한 스테롤 전달 경로에 대한 분자 기반을 확립합니다.


결과

ER과 Golgi 단지 사이에서 작동하는 운송 캐리어의 특성을 더 잘 이해하기 위해 우리는 살아있는 세포의 이러한 구획 사이에서 작동하는 다양한 클래스의 화물 분자의 공간 및 시간 역학을 따르기로 결정했습니다. KDEL 수용체(KDEL-R)는 극단적인 C-말단 테트라-펩티드 모티프 "KDEL"을 포함하는 가용성 화물을 골지체에서 다시 ER로 회수하는 기능을 하는 막관통 단백질의 한 예입니다(Lewis and Pelham, 1990). KDEL-R(GFP-KDEL-R)의 GFP 태그 버전을 인코딩하는 구조로 미세주입된 Vero 세포에서 시간 경과 현미경을 사용하여 병치 사이에서 이동하는 많은 수의 점 모양과 운동성이 높은 구조를 시각화할 수 있었습니다. 핵 골지 영역 및 세포 주변부(그림 1A 및 해당 동영상). 그러나, 점상 담체 외에, 집단의 다수의 세포에서 외관상 뚜렷하게 관형인 운동성 구조를 관찰하는 것도 가능했습니다(그림 1B, 화살촉 및 해당 영화). 이러한 관형 수송 중간체(TTI)는 길이가 가변적이었지만 대부분은 점상 운반체와 유사한 방식으로 고도로 운동성 순환을 하고 있었습니다. 놀랍게도, 세포에서 TTI의 출현은 주입된 플라스미드 DNA의 양에 크게 의존했습니다. 단순히 DNA 농도를 증가시키면 TTI를 포함하는 세포 수가 30%에서 50%로 증가했습니다(그림 1C). 이 현상이 이 구조에 특이적인지 확인하기 위해 이 실험을 반복했지만 이번에는 ER-Golgi 인터페이스의 또 다른 재활용 단백질인 GFP-tagged ERGIC-53을 인코딩하는 DNA를 미세주입했습니다(Schindler et al., 1993). 다시 한 번 인구의 일부 세포에서 TTI를 볼 수 있었지만 전반적으로 KDEL-R에서 볼 수 있는 것처럼 뚜렷하지 않았습니다(그림 1D 및 해당 영화). 그러나 KDEL-R에서 볼 수 있는 것과 유사한 경향에서 더 높은 농도의 플라스미드 DNA의 미세주입은 또한 고정된 기간 후에 TTI를 포함하는 세포의 빈도를 증가시켰습니다(미공개 데이터).

전사 및 번역에 사용할 수 있는 DNA의 양이 세포 내 TTI의 존재에 영향을 미치는 것으로 나타났기 때문에 다음으로 발현 시간이 역할을 할 수 있는지 고려했습니다. 이를 위해 우리는 이전의 미세 주입 실험을 반복했지만 이번에는 고정 농도의 DNA를 사용하고 발현 시간의 길이를 조정했습니다. 이러한 실험은 발현 시간과 집단에서 TTI의 빈도 사이의 명확한 상관 관계를 보여주었습니다(그림 1E). GFP-ERGIC-53 구조의 경우, 발현 1시간 후에 TTI를 함유하는 세포가 검출되지 않았지만, 이 비율은 5시간 후에 20%에 도달했습니다. 대조적으로, GFP-KDEL-R의 경우 단 1시간 후에 세포의 12%에서 TTI를 시각화하는 것이 이미 가능했으며 이 숫자는 5시간 후에 35%로 증가했습니다. 이보다 긴 배양 시간은 TTI를 포함하는 집단에서 세포의 빈도를 크게 증가시키지 않았습니다(미공개 데이터). 함께 이것은 더 많은 DNA의 가용성 또는 더 긴 발현 시간이 관형 ER-Golgi 운반체의 출현에 기여하는 요인임을 시사합니다. 이 두 가지 상황 모두 세포에서 더 많은 양의 단백질을 생성해야 하며, ERGIC-53과 KDEL-R의 경우에는 ER과 골지체 사이의 수송이 필요합니다. 따라서 우리는 위에서 설명한 시간 경과 실험을 조사하고 TTI를 포함하거나 포함하지 않는 개별 세포의 평균 형광을 정량화했습니다. GFP-KDEL-R을 발현하는 세포의 경우, 미세주입 후 모든 시점에서 TTI가 있는 세포는 없는 세포와 비교하여 증가된 형광 수준을 나타냈다(도 1F). 이것은 더 긴 발현 시간에서 가장 두드러졌습니다. 예를 들어 5시간 후에 TTI가 없는 세포는 TTI가 있는 세포의 형광의 평균 40%만 가졌습니다. GFP-ERGIC-53 구조를 사용한 실험에서도 유사하지만 덜 눈에 띄는 효과가 나타났습니다. 예를 들어, 발현 5시간 후 TTI가 없는 세포는 TTI가 있는 세포의 형광의 평균 60%를 가졌습니다(그림 1G). 우리의 접근 방식을 검증하고 증가된 형광이 단백질의 증가된 양과 상관관계가 있다는 것을 확신하기 위해, 우리는 Vero 세포를 GFP-KDEL-R 플라스미드 DNA로 형질감염시키고 증가된 시간 동안 배양했습니다. 우리는 미세 주입 실험과 유사한 관형 구조를 포함하는 많은 세포를 분명히 식별할 수 있었습니다. 각 시점에서 우리는 GFP-KDEL-R-발현 세포의 백분율을 시각적으로 결정하고, 이전과 같이 평균 형광을 정량화하고, 동일한 수의 형질감염된 세포를 SDS-PAGE 및 항-GFP 항체로 웨스턴 블로팅에 적용했습니다(그림1H). 시간이 지남에 따라 세포에서 GFP-KDEL-R 단백질의 양이 증가하는 것은 두 가지 분석 방법 모두에서 명확하게 감지할 수 있습니다. 따라서 우리는 형광 측정값을 단백질 양과 연관시키려고 했습니다. 예를 들어 그림 1F에서 TTI를 포함하는 세포의 형광 측정은 시간 경과에 따라 GFP-KDEL-R이 ~5.5배 증가함을 나타냅니다. 이것은 생화학적으로 측정하면 4.8배에 해당합니다. 이것은 발현된 단백질의 상대적인 증가를 결정하기 위해 형광을 사용하는 접근 방식이 보다 전통적인 생화학적 기술과 유사한 결과를 산출했음을 확인시켜 주었습니다.

우리가 GFP 태그 단백질로 분석한 KDEL-R 및 ERGIC-53 TTI가 조작되지 않은 Vero 세포에서 내인성 대응물과 함께 관찰될 수 있는지 여부를 조사하기 위해 우리는 이러한 단백질에 대해 세포를 고정하고 면역염색했습니다. GRASP65 및 실제로 KDEL-R과 같은 많은 ER-Golgi 재활용 단백질은 이전에 관 구조에 존재하는 것으로 보고되었습니다(Marra et al., 2001). 우리는 또한 이 초기 연구(그림 2)와 유사한 이 특성을 가진 많은 세포를 감지할 수 있었지만, 집단에서 그러한 세포의 발생은 일반적으로 2% 미만이었습니다. 또한 그림 1의 GFP 태그 단백질에서 볼 수 있는 상황과 달리 세포당 이러한 관형 구조의 수도 매우 낮았으며 일반적으로 감지할 수 있는 세포에서 한 개 또는 두 개만 볼 수 있습니다. 이 낮은 세관 풍부가 고정 후 이러한 구조의 열악한 보존 때문일 가능성과 이 접근법이 TTI의 역학에 대한 정보를 제공할 수 없다는 사실을 배제할 수 없었기 때문에 우리는 형광 태그가 붙은 리포터를 사용하여 살아있는 세포 실험으로 되돌아갔습니다.

KDEL-R과 ERGIC-53은 모두 막횡단 단백질이기 때문에 다음으로 TTI 형성이 관찰되고 가용성 카고로 유사하게 조절될 수 있는지 고려했습니다. Lumenal/soluble GFP는 단백질을 ER lumen으로 표적화하기 위해 신호 펩타이드를 포함하는 GFP의 이전에 설명된 변형이지만, 다른 표적화 정보를 포함하지 않기 때문에 ER에서 빠르게 내보내지고 다음을 통해 세포에서 추방됩니다. 고전적인 분비 경로(Blum et al., 2000). 가용성 GFP의 ER-to-Golgi 수송의 물결을 따르기 위해서는 ERGIC 구획에 새로 합성된 화물을 축적하기 위해 먼저 세포를 15°C에서 배양할 필요가 있었습니다(Saraste and Kuismanen, 1984).온도 차단이 해제되면 가용성 GFP가 세포의 핵 인접 골지 영역을 향해 빠르게 이동하는 것으로 관찰되었으며, 대부분의 경우 이 위치에서 기존 구조와 융합되는 것으로 나타났습니다. 이러한 수송 중간체는 크기가 매우 다형적이었지만, 집단 내에서 운반체가 모양이 점각인 세포(그림 3A 및 해당 영화)와 TTI가 더 널리 퍼져 있는 다른 세포(그림 3B, 화살촉 및 해당 영화). 우리는 먼저 시간을 늘리기 위해 15°C에서 세포를 유지한 다음 37°C에서 5분 후에 TTI를 포함하는 집단에서 세포의 비율을 결정하는 효과를 조사하기로 결정했습니다. 이러한 실험은 15°C 블록의 길이가 집단 내 TTI 함유 세포의 전체 빈도에 거의 영향을 미치지 않았으며 일반적으로 세포의 60%가 식별 가능한 관형 운반체를 갖는 것으로 나타났습니다(그림 3C). 다음으로 우리는 TTI가 없는 세포와 비교하여 이들 세포의 화물 발현 수준을 고려했습니다. 우리는 TTI가 있는 세포가 TTI가 없는 세포보다 평균 40% 더 많은 단백질을 발현한다는 것을 일관되게 발견했는데, 이는 막횡단 단백질로 얻은 결과와 유사했지만 15°C에서 시간과 무관합니다(그림 3D).

그림 1. GFP-KDEL-R 및 GFP-ERGIC-53의 발현 수준은 TTI 풍부도에 영향을 미칩니다. (A) 적은 양의 GFP-KDEL-R을 발현하는 Vero 세포는 골지체 및 운동성 점상 구조에 국한된 단백질을 보여줍니다. (B) 더 높은 수준의 GFP-KDEL-R을 발현하는 Vero 세포는 운동성 관형 운반체(화살촉)에도 존재하는 단백질을 보여줍니다. (C) Vero 세포에 GFP-KDEL-R을 인코딩하는 두 가지 다른 농도의 플라스미드 DNA를 미세주입하고 5시간 동안 배양했습니다. 별개의 TTI를 갖는 집단에서 세포의 빈도가 결정되었다. 오차 막대는 중복 실험 간의 평균과 SD를 나타냅니다. (D) GFP-ERGIC-53을 발현하는 Vero 세포는 소포 구조에 우세하게 존재하지만 일부 세포에서는 운동성 관형 운반체(화살촉)에도 존재하는 단백질을 보여줍니다. (E) Vero 세포에 GFP-KDEL-R 또는 GFP-ERGIC-53을 암호화하는 50ng/㎕ 플라스미드 DNA를 미세주입하고 증가하는 시간 동안 배양하였다. 별개의 TTI를 갖는 집단에서 세포의 빈도가 결정되었다. (F) 세포당 평균 GFP-KDEL-R 형광을 E의 세포로부터 결정하고 TTI를 포함하는(검은색 막대) 및 포함하지 않는 세포(회색 막대)에 대해 플롯팅했습니다. (G) 세포당 평균 GFP-ERGIC-53 형광은 발현 5시간 후 E의 세포로부터 결정되었다. (H) Vero 세포를 GFP-KDEL-R을 인코딩하는 플라스미드 DNA로 형질감염시키고 표시된 시간 동안 배양하였다. 세포당 평균 형광은 각 시점(삼각형)에 대해 결정되었습니다. 또한 각 시점에서 동일한 수의 형질감염된 세포를 용해하고 항-GFP 항체를 사용한 SDS-PAGE 및 웨스턴 블로팅(삽입 참조)을 수행하고 회수된 GFP-KDEL-R 단백질의 양을 정량화했습니다(사각형). 시간 경과에 따라 기울기의 평균 값은 1.355(오점) 및 1.511(형광)이었습니다. EG의 오차 막대는 중복 실험 간의 평균과 SD를 나타냅니다. 바, 10μm. 영화는 A, B, D를 동반합니다.

그림 2. 내인성 TTI의 시각화. (A-D) 37°C에서 성장하는 Vero 세포를 고정하고 내인성 KDEL-R(A 및 B) 및 ERGIC-53(C 및 D)에 대해 면역염색했습니다. 세포의 작은 개체군에는 가시적인 관형 구조(화살촉)가 포함되어 있습니다. 삽입된 그림은 두 개의 화살촉으로 표시된 관형 구조의 확대를 보여줍니다. 바, 10μm.

수송과 관련하여 TTI의 중요성을 더 자세히 이해하기 위해 우리는 개별 세포를 기반으로 구조를 조사했습니다. 처음에 우리는 15°C에서 1시간 또는 5시간 동안 배양된 세포에서 뚜렷한 점 모양과 관형 구조의 수를 세었습니다. 우리는 5시간의 배양 후 개별 세포가 1시간 동안만 배양된 세포보다 50% 더 많은 가용성 GFP 함유 관형 구조를 가졌으며(그림 3E), 두 경우 모두에서 이들 중 90%가 운동성을 가졌다는 것을 기록했습니다(그림 3F, 검은색 막대 ). 대조적으로, 반점 구조의 약 40%만이 운동성을 나타내었습니다(그림 3F, 회색 막대). 그러나 각 세포의 운동성 구조만 고려할 때 배양 시간에 관계없이 TTI는 전체 수송 캐리어 수의 약 40%에만 기여한다는 것을 발견했습니다(그림 3G). 따라서 배양 시간이 길어질수록 각 셀에서 관형 구조의 비율이 더 높아지지만 그 자체로 화물 운송 증가에 기여하지는 않았습니다. 따라서 점 모양 캐리어와 비교하여 TTI의 역할은 무엇입니까? 마지막으로 두 가지 유형의 운송업체가 이동한 평균 거리를 고려했습니다. 재현 가능하게 우리는 관형 캐리어가 이 실험에 사용된 고정된 시간 간격에서 8μm에 비해 평균 13μm인 점상 캐리어보다 60% 더 멀리 이동한다는 것을 발견했습니다(참조: 재료 및 방법 자세한 내용은 그림 3H).

가용성 GFP 수송 운반체에 대한 더 자세한 분석은 세포 내에서 이 화물의 짧은 체류 시간 때문에 어려웠습니다. 따라서 우리는 초기 분비 경로의 재활용 요소에 집중하기로 결정했습니다. p24 단백질군은 살아있는 세포에서 ER과 골지 복합체 사이에서 순환하는 것으로 관찰된 작은 단일 막횡단 분자입니다(Blum et al., 1999). 그들의 정확한 기능은 아직 밝혀지지 않았으며 이러한 구획 사이의 추정 화물 수용체로서의 역할이 하나의 가능성이기는 하지만(Muniz et al., 2000), 효모에서 최소한 이들의 존재는 소포 수송에 필수적이지 않습니다(Springer et al., 2000). 보다 균질한 세포 집단으로 작업하기 위해 우리는 p24 단백질의 YFP 태그 버전을 발현하는 안정적인 HeLa 세포주를 구성했습니다(참조 재료 및 방법 자세한 내용은). 이러한 세포의 SDS-PAGE 및 웨스턴 블로팅은 태그가 지정된 단백질이 예상 분자량으로 이동하는 것으로 나타났습니다(그림 4A). p24 밴드의 강도를 정량화한 후, 이 모집단의 세포 중 18%만이 실제로 태그가 지정된 p24 단백질을 발현하고 있다는 점을 고려하여 과발현 수준이 내인성보다 3.5배 더 높은 것으로 결정했습니다. 다음으로 우리는 내막 시스템의 알려진 마커로 면역 염색을 사용하여 p24-YFP 단백질의 세포 내 위치를 분석했습니다. 37°C에서 단백질은 핵병치 골지 위치 및 다수의 뚜렷한 주변 구조에서 발견되었으며 전체적으로 COPI 코트 복합체에서 관찰된 것과 유사한 분포를 나타냅니다(그림 4B). 이 발견은 초미세구조 수준에서 이 두 단백질의 이전 colocalization 연구와 잘 일치했습니다(Lavoie et al., 1999). 또한 p24-YFP 단백질은 p24 단백질 패밀리의 또 다른 구성원인 p27과 골지 영역에서 양호한 중첩을 나타내었지만(그림 4D), 이 항체로 주변 p27 구조가 거의 시각화되지 않았습니다. 내인성 KDEL-R 및 ERGIC-53과의 강력한 colocalization과 COPII subunit sec23(미공개 데이터)과의 부분적인 colocalization도 관찰되었습니다. 대조적으로 p24-YFP와 p24-YFP의 중복은 거의 없었습니다. 트랜스-골지 네트워크(TGN) 및 엔도솜 코트 복합체 AP-1(그림 4C)은 초기 분비 경로에서 p24-YFP의 올바른 분포를 모두 나타냅니다. 마지막으로 우리는 수포성 구내염 바이러스 당단백질(VSV-G)의 온도에 민감한 변이체(ts045G)를 화물 마커로 사용하여 분비 분석을 수행하고 원형질막에 도달하는 것을 관찰하여 이러한 세포의 기능을 평가했습니다(그림4E) . 우리는 인구에서 형질전환되지 않은 세포와 비교하여 형질전환된 세포에서 ts045G의 분비 속도의 차이를 감지할 수 없었으며, 이는 과발현된 p24-YFP의 존재가 ts045G에 의해 강조된 바와 같이 정상적인 막 인신매매 사건에 거의 영향을 미치지 않는다는 것을 시사합니다.

그림 3. 가용성 GFP 화물은 TTI 풍부도에 영향을 미칩니다. (A 및 B) 15°C에서 3시간 동안 화물을 축적한 후 5분 동안 37°C로 온도를 이동시킨 후 가용성 GFP를 발현하는 HeLa 세포. 일부 셀은 소포 운반체(A)를 통한 화물 운송을 보여주고 다른 셀은 TTI(화살촉 B)를 통해 운송합니다. (C) 가용성 GFP를 발현하는 HeLa 세포를 15°C에서 증가된 시간 동안 인큐베이션한 다음, 37°C에서 5분 동안 인큐베이션했습니다. 별개의 TTI를 갖는 집단에서 세포의 빈도가 결정되었다. (D) 세포당 평균 가용성 GFP 형광은 1시간 및 5시간 시점에서 C의 세포에서 결정되었으며 TTI를 포함하는(검은색 막대) 및 포함하지 않는 세포(회색 막대)에 대해 플롯팅됩니다. (E 및 F) 표시된 대로 15°C에서 다양한 시간 동안 인큐베이션한 개별 세포에서 소포 대 TTI 운반체의 분석에 이어 37°C에서 5분 동안 인큐베이션합니다. 무작위로 선택된 별개의 주변 구조를 계수하고 수포형 또는 관형으로 결정했습니다. (E) 다양한 시점에서 관형 구조의 백분율이 표시됩니다. (F) 운동성이었던 구조의 백분율이 표시됩니다. 회색 막대는 수포성 운반체입니다. 검은색 막대는 관형 운반체입니다. (G) 운동성 구조만 계산되었으며, 이들은 소포형 또는 관형으로 결정되어 운동성/수송에 대한 상대적 기여도를 결정할 수 있습니다. 회색 막대는 수포성 운반체입니다. 검은색 막대는 관형 운반체입니다. (H) 운동성 구조에 의해 이동된 거리가 결정되었습니다. 회색 막대는 수포성 운반체이고 검은색 막대는 관형 운반체입니다. C 및 D의 오차 막대는 중복 실험 간의 평균 및 SD를 나타냅니다. E–H의 오차 막대는 개별 셀 사이의 평균과 SD를 나타냅니다. 바, 10μm. 영화는 A와 B를 동반합니다.

그림 4. p24-YFP를 안정적으로 발현하는 HeLa 세포주의 특성화. (A) p24-YFP를 안정적으로 발현하는 HeLa 세포를 용해시키고 항-GFP 또는 항-p24 항체로 SDS-PAGE 및 웨스턴 블로팅을 실시하였다. 블롯은 내인성 p24 단백질의 존재와 예상 크기에서 과발현된 p24-YFP를 보여주었습니다. 웨스턴 분석에 사용된 세포 집단에서 18%만이 p24-YFP를 포함했습니다(미공개 데이터). p24 및 p24-YFP 밴드의 정량화와 함께 3.5배의 p24-YFP 과발현 수준이 결정되었습니다. (B-D) HeLa p24-YFP 세포는 COPI 코트 복합체(B), AP-1 코트 복합체(C) 및 p27 단백질(D)에 대해 고정되고 면역염색되었습니다. AP-1이 아닌 COPI 및 p27과 p24-YFP의 높은 수준의 동시국재화가 관찰되었습니다. (E) HeLa p24-YFP 세포는 화물 마커로 VSV-G 단백질의 온도 민감성 변이체(ts045G)를 사용하여 분비 분석을 받았습니다. p24-YFP 발현 세포와 비발현 세포 사이에 ts045G의 원형질막(PM) 전달에 약간의 차이가 관찰되었습니다. B-D의 화살표는 공동 국소화 구조를 나타내고 화살촉은 비동소화 구조를 나타냅니다. E의 오차 막대는 개별 셀 사이의 평균과 SD를 나타냅니다. E의 별표는 90분 시점의 대표적인 이미지와 함께 p24-YFP 발현 세포를 나타냅니다. 바, 10μm.

살아있는 세포에서 점 모양의 p24-YFP 구조는 세포 주변부와 핵 인접 영역 사이에서 지속적으로 움직이는 매우 운동성이 있는 것으로 나타났습니다(그림 5A 및 해당 영화). 다시 우리는 소포성 운반체보다는 관형 운반체를 포함하는 세포에 대한 모집단을 조사했습니다. 37°C 정상 상태 조건에서 TTI는 세포의 18%에서만 검출되었으며, 이는 수송이 주로 소포성 운반체에 의해 매개되고 있음을 시사합니다. P24는 ERGIC 구획을 통해 순환하기 때문에 우리는 용해성 GFP 실험에서 사용된 바와 같이 온도 블록을 사용하여 이 구획에 p24-YFP 화물의 축적을 생성하려고 시도했습니다. 이러한 온도 처리는 이전에 이 위치에서 ERGIC-53의 점진적인 축적을 일으키는 것으로 나타났습니다(Klumperman et al., 1998). 우리는 15°C에서 30분 또는 60분 동안 세포를 배양한 다음 37°C로 다시 이동하고 추가 5분 후에 이미지를 생성했습니다. 우리는 대조군 조건(그림 5B, 화살촉 및 해당 영화)과 비교하여 현재 TTI를 포함하는 인구의 세포 빈도가 현저하게 증가하는 것을 관찰했습니다. 예를 들어 ERGIC 구획에서 1시간 동안 수송이 정지되면 현재 TTI를 포함하는 세포 수가 거의 3배 증가했습니다(그림 5C). 이러한 세뇨관 유병률의 증가는 개별 세포 내에서도 볼 수 있었습니다. 별개의 점 모양 및 관형 구조를 계산한 결과 37°C 제어 조건에서 TTI는 전체 구조 수의 10%만 구성한 반면, 온도 블록에서 방출 직후 시간에 이 비율은 18%로 상승했습니다(그림 5D). 개별 세포 내 TTI 풍부도의 이러한 증가는 37°C에서 30분 배양 후 대조군 수준으로 돌아갔으며, 이는 이것이 적용된 조건(미공개 데이터)에 대한 일시적인 반응임을 나타냅니다. 그러나 다양한 온도 처리 후 TTI의 실제 길이는 일정하게 유지되었습니다(표 1).

1 번 테이블. 다양한 처리 후 HeLa p24-YFP 세포의 TTI 길이 정량화

그림 5. 온도 블록에서 방출하면 TTI 형성이 향상됩니다. (A) 37°C에서 p24-YFP를 안정적으로 발현하는 HeLa 세포. (B) p24-YFP를 안정적으로 발현하는 HeLa 세포를 15°C에서 30분 동안 배양한 다음 37°C에서 5분 동안 배양했습니다. 관형 캐리어가 훨씬 더 두드러집니다(화살촉). (C) p24-YFP를 안정적으로 발현하는 HeLa 세포를 37 또는 15°C에서 30분 또는 60분 동안 배양한 다음 37°C에서 5분 동안 배양했습니다. 별개의 TTI를 갖는 집단에서 세포의 빈도가 결정되었다. (D-G) 위에서 설명한 온도 체제에서 배양된 개별 세포에서 소포 대 TTI 운반체의 분석. 무작위로 선택된 별개의 주변 구조를 계수하고 수포형 또는 관형으로 결정했습니다. (D) 다양한 조건에서 관형 구조의 백분율이 표시됩니다. (E) 운동성이었던 구조의 백분율이 표시됩니다. 회색 막대는 수포성 운반체입니다. 검은색 막대는 관형 운반체입니다. (F) 운동성 구조만 계산되었으며, 이들은 소포형 또는 관형으로 결정되어 운동성/수송에 대한 상대적 기여도를 결정할 수 있습니다. 회색 막대는 수포성 운반체입니다. 검은색 막대는 관형 운반체입니다. (G) 운동성 구조에 의해 이동된 거리가 결정되었습니다. 회색 막대는 수포성 운반체입니다. 검은색 막대는 관형 운반체입니다. C의 오차 막대는 세 번의 반복 실험 사이의 평균과 SD를 나타냅니다. D–G의 오차 막대는 개별 셀 사이의 평균과 SD를 나타냅니다. 바, 10μm. 영화는 A와 B를 동반합니다.

다음으로 운송에 있어 관형 캐리어의 중요성을 조사했습니다. 우리는 실험 과정 동안의 조건에 관계없이 평균적으로 세포에서 TTI의 90%가 이동하고 있었으며, 이는 가용성 GFP 화물의 결과와 유사했습니다(그림 5E, 검은색 막대). 그러나 모든 이동 캐리어에 의해 만들어진 운동성에 대한 기여를 계산할 때 온도 블록에서 해제된 후 TTI가 이제 제어 조건과 비교하여 이동 구조의 총 수의 두 배(40%)를 차지한다는 것을 관찰했습니다(그림 5F). 마지막으로 두 종류의 운송 중간체에 의해 이동한 거리를 비교했습니다. 다양한 배양 조건이 이동 거리에 크게 영향을 미치지는 않았지만 일부 TTI 구조는 종종 매우 먼 거리(최대 20μm)로 이동하는 것을 관찰했지만 이 집단의 확산으로 인해 최종 평균은 기록된 것과 크게 다르지 않았습니다. 소포 캐리어(그림 5G).

위의 결과는 기증자 막에서 수송 적격 화물의 강제 축적 및 후속 방출이 관형 운반체의 형성에 기여함을 나타냅니다. 이러한 구조의 최종 목적지는 소포 운반체와 동일한 멤브레인일 가능성이 높기 때문에 유사한 운송 기계가 사용되었는지 여부를 결정하는 것이 궁금했습니다. ER과 Golgi 사이의 양방향 수송은 미세소관 세포골격을 포함하는 것으로 알려져 있습니다. 노코다졸을 사용하는 이 네트워크의 중단은 이러한 막 사이의 역행 및 전행 수송을 모두 극적으로 감소시키는 다양한 연구에 의해 입증되었습니다(Lippincott-Schwartz et al., 1990 저울 et al., 1997). 이러한 연구에서는 미세소관이 수송 효율을 높이는 역할만 한다고 제안했지만, 필연적으로 이러한 구획 사이의 물질 흐름 감소는 수송 능력이 있는 화물의 점진적인 축적을 초래할 가능성이 있습니다. 다시 우리는 이 실험을 위해 p24-YFP 발현 세포를 사용했고 TTI 형성을 안정적으로 유도하기 위해 15°C에서 30분 배양 후 37°C에서 5분 방출의 제어 조건을 사용했습니다. 처음에 우리는 미세소관 세포골격이 실제로 해중합되었고 과발현된 p24-YFP 단백질이 이 과정을 방해하지 않는다는 것을 확인하기 위해 이 처리 후 세포를 고정했습니다(그림 6A). 또한 우리는 또한 세포에 대한 면역 염색 시스-골지 마커 GM130 및 TGN 마커 TGN46, 골지 복합체가 여전히 손상되지 않았는지 확인합니다(그림 6B). 다음으로 우리는 살아있는 세포에서 구조를 포함하는 p24-YFP의 운동성을 분석했습니다. 노코다졸이 15°C에서 30분 배양 동안 포함되고 세포를 37°C로 가온한 후에도 우리는 여전히 존재하는 다수의 관형 구조를 관찰했습니다(그림 6C, 화살촉 및 해당 영화). 그러나 이러한 실험을 반복했지만 노코다졸이 씻겨 나가면 이러한 세관이 더 두드러지게 되었습니다(그림 6D, 화살촉 및 해당 동영상). 이러한 TTI의 평균 길이도 대조군에 비해 증가했습니다(표 1). 세포 집단 내에서 우리는 노코다졸이 있을 때 TTI를 포함하는 세포의 빈도가 30%에서 45%로 증가하고 노코다졸 제거 후 75%로 훨씬 더 극적인 증가를 관찰했습니다(그림 6E). 노코다졸 세척 30분 후 세포를 분석한 결과 집단에서 TTI의 대조군 수준이 밝혀졌습니다(미공개 데이터). 노코다졸 처리는 가시적인 세관을 포함하는 더 많은 세포를 초래했지만, 개별 세포에서 이들의 실제 수를 보았을 때, 우리는 그 수가 감소했을 뿐만 아니라(노코다졸 처리된 세포의 총 별개 구조의 18%에서 8%로) 발견했습니다. 6F), 그러나 운동성을 가진 사람은 극소수였습니다(그림 6G). 모든 수송 구조의 운동성이 이 치료에 의해 제거될 것으로 예상되었을 수 있지만, 미세소관 세포골격에 대한 이전의 면역염색은 이 시점에서 소수의 매우 짧은 미세소관이 여전히 세포에 존재한다는 것을 밝혀냈습니다(그림 6A, 삽입 및 화살촉). 이 세포에서 우리는 또한 p24-YFP TTI와 소포 요소가 이러한 미세 소관 잔재와 함께 국소화되어 우리가 감지한 잔류 운동성이 이러한 구조에서 일어나고 있을 가능성이 있음을 관찰할 수 있었습니다. 노코다졸을 제거하면 개별 세포에서 TTI의 존재가 증가했으며(모든 구조의 25% 그림 6F), 이들의 운동성은 대조군과 유사했습니다(그림 6G). 유사하게, 노코다졸로 처리된 세포의 전체 운동성에 대한 TTI 기여는 거의 감지할 수 없었습니다(그림 6H).노코다졸이 있는 상태에서 TTI가 이동한 거리의 분석도 평균적으로 2μm 이상을 이동할 수 없음을 보여주었으며(그림 6I), 검출할 수 있는 미세소관 잔존물의 길이와 일치합니다(그림 6A).

막 교통은 수송 운반체의 세포질 면과 관련된 다양한 다른 요인에 의존하는 것으로 알려져 있습니다. 여기에는 작은 GTPase의 Rab 제품군이 포함됩니다(Deneka에서 검토됨 et al., 2003), COPI 및 COPII 코트 복합체(Barlowe, 2000에서 검토). 또한 p24 단백질 자체도 ER과 Golgi 사이의 수송 조절과 관련이 있습니다(Lavoie et al., 1999 Belden 및 Barlowe, 2001). TTI 형성 및 운동성과 관련하여 이러한 요인의 중요성을 테스트하기 위해 우리는 이러한 구성요소를 차례로 선택적으로 방해하는 다양한 제제를 미세주입한 다음 TTI 형성을 촉진하기 위해 이전과 같이 15°C 및 37°C에서 세포를 배양했습니다. 처음에 우리는 p24 및 p23 단백질의 세포질 꼬리를 나타내는 합성 펩티드를 주입했습니다. 그들의 존재는 세포에 있는 모든 운반체의 풍부함과 운동성에 극적인 영향을 미쳤습니다(그림 7, A 및 B 및 해당 영화). TTI는 이러한 세포에서 거의 감지할 수 없었고(그림 7F), 식별된 몇 개는 운동성을 나타내지 않았습니다(그림 7, G–I, 검은색 막대). 또한, 소포성 운반체의 운동성은 또한 이들 세포에서 극적으로 감소되었는데, 예를 들어 p24 꼬리 펩티드가 주입되었을 때 이들 구조의 <5%는 임의의 유의한 움직임을 나타내었다(도 7G). 이 놀라운 결과가 세포로의 펩타이드 미세주입의 비특이적 효과가 아니라는 것을 확인하기 위해 우리는 p24의 내강 도메인의 일부를 나타내지만 p24 꼬리 펩타이드와 유사한 pI 및 길이를 갖는 세 번째 펩타이드를 설계했습니다. 이 펩티드로 미세주입되고 이전과 동일한 온도 체제로 처리된 살아있는 세포에서 p24-YFP 구조(관 및 소포 모두)의 운동성은 비주입 세포를 제어하는 ​​것과 유사한 것으로 관찰되었습니다(그림 7C). 이들 세포로부터의 p24-YFP 운동성의 상세한 정량화는 또한 대조군 비주입 세포에 필적하는 프로파일을 나타냈다(도 7, F-I).

TTI 활성에 대한 Rab 단백질의 중요성을 테스트하기 위해 다음으로 정제된 Rab-GDI(GTPase 해리 억제제) 단백질을 주입했습니다. Rab-GDI는 일반적으로 세포질에서 기능하고 막으로 전달되기 전에 Rab 단백질을 가용성, 비활성 상태로 유지합니다. Rab-GDI가 주입된 세포에는 매우 적은 수의 관형 구조(그림 7D 및 해당 영화 및 그림 7F)만 포함되어 있으며 이 세포에서 운동성 TTI를 감지할 수 없었습니다(그림 7G-I, 검은색 막대). p23 및 p24 펩티드를 사용한 실험과 유사했습니다. 마지막으로 우리는 가수분해가 잘 되지 않는 GTP 유사체인 GTPγS를 세포에 주입했습니다. GTPγS는 수송 능력이 있는 구조에 코트 복합체를 잠그는 효과가 있습니다. GTPγS가 주입된 세포의 검사에서 우리는 관형 구조의 큰 망상 네트워크를 관찰했습니다(그림 7E, 화살촉 및 해당 영화). 세포 내에서 이러한 세관의 빈도는 대조군 세포보다 훨씬 높았고(그림 7F), 세포에서 관찰된 전체 수송에 여전히 기여하고 있었습니다(그림 7, G–I, 검은색 막대). 그러나 이 처리가 운동성과 관련하여 가장 작은 영향을 미치는 것으로 나타났음에도 불구하고 이들 세포에서 생성된 세관은 평균 길이가 2.7에서 5.6 μm로 증가하여 가장 극적이었습니다(표 1).

그림 6. TTI 운동성은 온전한 미세소관 세포골격에 의존합니다. (A 및 B) HeLa p24-YFP 세포를 15°C에서 30분 동안 배양한 다음 α-tubulin(A) 또는 GM130에 대한 고정 및 면역 염색 전에 10μM 노코다졸의 존재 하에 37°C에서 5분 동안 배양했습니다. TGN46(B). 이러한 조건에서 미세소관 세포골격은 거의 완전히 분산되었지만 골지체 복합체와 TGN은 핵 병치 위치를 유지했습니다. 미세 소관의 잔해는 종종 p24-YFP 소포 및 관 구조와 함께 국소화됩니다(A 삽입, 화살촉). 별표는 p24-YFP 발현 세포를 나타냅니다. (C) p24-YFP를 안정적으로 발현하는 HeLa 세포를 10μM 노코다졸의 존재하에 15°C에서 30분 동안 배양한 다음 37°C에서 5분 동안 배양했습니다. 짧은 비운동성 TTI가 관찰될 수 있습니다(화살촉). (D) p24-YFP를 안정적으로 발현하는 HeLa 세포를 10 μM 노코다졸의 존재 하에 15°C에서 30분 동안 배양한 다음, 노코다졸을 세척하고 세포를 37°C에서 5분 동안 배양하였다. 이제 더 긴 TTI를 관찰할 수 있습니다(화살촉). (E) p24-YFP를 안정적으로 발현하는 HeLa 세포를 상기한 바와 같이 배양하고, 별개의 TTI를 갖는 집단에서 세포의 빈도를 결정하였다. 대조군 세포를 모두 노코다졸 없이 15°C에서 30분 동안 배양한 다음 37°C에서 5분 동안 배양했습니다. (F-I) 위에서 설명한 노코다졸 처리하에 배양된 개별 세포에서 수포 대 TTI 운반체의 분석. 무작위로 선택된 별개의 주변 구조를 계수하고 수포형 또는 관형으로 결정했습니다. (F) 다양한 조건에서 관형 구조의 백분율이 표시됩니다. (G) 운동성이었던 구조의 백분율이 표시됩니다. 회색 막대는 수포성 운반체입니다. 검은색 막대는 관형 운반체입니다. (H) 운동성 구조만 계산되었으며, 이들은 소포형 또는 관형으로 결정되어 운동성/수송에 대한 상대적 기여도를 결정할 수 있습니다. 회색 막대는 수포성 운반체입니다. 검은색 막대는 관형 운반체입니다. (I) 운동성 구조에 의해 이동된 거리가 결정되었습니다. 회색 막대는 수포성 운반체입니다. 검은색 막대는 관형 운반체입니다. E의 오차 막대는 세 번의 반복 실험 사이의 평균과 SD를 나타냅니다. F–I의 오차 막대는 개별 셀 사이의 평균과 SD를 나타냅니다. 바, 10μm. 영화는 C와 D를 동반합니다.

TTI의 형성을 시도하고 조절하는 데 사용된 모든 시약에서 p23 및 p24 단백질의 펩타이드 꼬리가 가장 효과적인 것으로 나타났습니다. ER과 Golgi 복합체 사이의 수송은 COPI 및 COPII 코트 복합체의 활성에 크게 의존하기 때문에 우리는 이러한 펩타이드가 주입된 세포에서 이러한 코트를 시각화하기로 결정했습니다. 놀랍게도 우리는 이들 세포에서 소포 및 관 운동성이 모두 결여되어 있음에도 불구하고 두 코트 모두 비교적 정상적인 외양을 갖고 뚜렷한 막 구조에 주로 존재하는 것으로 관찰되었음을 관찰했습니다. p23(도 8A) 및 p24 꼬리 펩티드(도 8B) 모두가 주입된 세포에서 유사한 관찰이 이루어졌다.


결과

ER에서 골지로 비서 돌연변이는 스핑고지질 합성을 완전히 차단하지 않습니다

효모에서 가장 단순한 스핑고지질인 IPC는 골지 효소인 Aur1p에 의해 PI에서 세라마이드로 이노시톨포스페이트를 전달하여 만들어집니다(Dickson and Lester, 1999 Schneiter, 1999 Levine et al., 2000). 이전 연구에서는 ER-to-Golgi 소포 수송이 온도에 민감한 분비 돌연변이체에서 차단된 경우에도 방사성 표지된 DHS 또는 myo-inositol에서 IPC를 합성할 수 있음을 보여주었습니다.초12, -16, -17, -18, 그리고 -23) 제한 온도에서 (Puoti et al., 1991 Reggiori and Conzelmann, 1998). 완전한 억제의 결여가 ER에서 차단된 채로 남아 있는 새로 합성된 IPC 합성효소 때문일 가능성을 배제하기 위해 단백질 합성 억제제인 ​​cycloheximide(Chx)가 있는 상태에서 실험을 반복했습니다. 야생형 또는 초18 돌연변이 세포를 24°C에서 성장시킨 다음 Chx와 사전 인큐베이션한 후 24°C 또는 37°C에서 2시간 동안 [3H]DHS로 대사적으로 표지했습니다(그림 1A). 지질을 추출하고 약한 알칼리 가수분해에 의해 탈아실화하여 방사성 표지된 지질을 식별하고 TLC로 분리하였다. 포스파티딜에탄올아민, 포스파티딜콜린(PC) 및 PI는 약한 알칼리성 가수분해에 완전히 민감한 반면, 스핑고지질은 내성이었습니다. [ 3 H]myo-inositol–radiolabeled 지질 혼합물과 [ 3 H]DHS-1-phosphate (DHS-1-P)는 [ 3 H]DHS와 효모 세포질, ATP 재생 시스템에서 시험관 내에서 제조되었으며 표준으로 사용되었습니다. PI, IPC/B, IPC/C 및 DHS-1-P를 식별합니다. 37°C에서 야생형 세포는 24°C에 비해 IPC/C 합성이 감소했습니다. 이 감소는 Chx가 없는 경우 감소가 발견되지 않았기 때문에 Chx의 존재로 인한 것입니다(미공개 데이터). 예상대로, 초18 37°C에서 야생형에서 합성된 IPC/C 양의 30-45%만 만들었습니다. 이것은 IPC/C 합성의 감소가 약간 증가했지만 라벨링이 30분 동안 수행된 경우에도 나타났습니다(그림 1B). 다음과 같은 다른 돌연변이체에서도 유사한 결과를 관찰할 수 있습니다. 초17, 초12, 그리고 초23, 남아있는 운송량은 다양하지만. 결과 초12 그리고 초23 ER에서 Golgi로의 수송에 더 특이적인 돌연변이 초18, 골지 세라마이드 수송에 대한 ER의 ~40-50%가 우리 조건에서 비소포성임을 시사합니다. 우리의 결과는 IPC/C가 ER-to-Golgi 소포 수송과 독립적으로 합성될 수 있고 비소포 경로의 중요성을 보여주고 있다고 보고한 이전 연구를 확인합니다.

체외에서 세라마이드 및 IPC 합성

우리의 목표는 새로 합성된 세라마이드가 IPC로 전환되는 부위로 이동하는 기본 메커니즘을 연구하는 것입니다. 분리된 소기관을 사용하는 시험관 내 시스템이 강력한 도구가 될 것이기 때문에 우리는 먼저 [ 3 H]DHS의 마이크로솜 막에 의한 IPC 합성을 조사했습니다. 마이크로솜 막을 세포질, ATP 재생 시스템, GDP-만노스, 조효소 A, 헥사코사노산(C26) 및 PI를 함유하는 리포솜과 함께 24°C에서 배양했을 때 IPC의 두 하위 분류(IPC/B 및 IPC/C)는 합성. IPC/B와 IPC/C는 [ 3 H]myo-inositol-labeled standard와 함께 염기 저항성이 있고 PI-PLC에 민감하며(그림 2A), 이들의 합성은 aureobasidin A(AbA)에 의해 차단되었다. IPC 합성(그림 3A)(Zhong et al., 1999).

세라마이드의 정체는 화학적 특성과 세라마이드 합성의 특정 억제제를 사용하여 확립되었습니다. 시험관 내에서 합성된 염기 내성 IPC 및 추정된 세라마이드를 스크래핑한 후 PI-PLC 및/또는 HCl 처리를 통해 TLC 플레이트에서 정제했습니다(그림 2, B-D). 추정된 세라마이드(그림 2B, 레인 5)는 PI-PLC(그림 2B, 레인 2)로 처리된 염기 내성 IPC에서 파생된 세라마이드와 함께 이동하여 스핑고이드 염기 DHS 및 PHS와 강한 표면에서 미확인 지질 X를 생성했습니다. 용매 시스템 I에서 HCl 가수분해(그림 2B, 레인 3, 4, 7 및 8). 용매 시스템 III를 사용하는 경우 PI-PLC 처리된 IPC에서 두 가지 다른 세라미드가 분리될 수 있습니다(그림 2C, 레인 2). 추정된 세라마이드 분획에서 우리는 두 개의 세라마이드보다 더 멀리 이동하고 HCl에 의해 가수분해된 하나의 추가 지질 Z를 관찰했습니다(그림 2C, 레인 5 및 6). 우리는 이 지질의 정체를 더 이상 조사하지 않았습니다. 두 개의 세라마이드 *I 및 *II(그림 2C, 레인 6)를 정제하고 HCl로 개별적으로 가수분해했습니다. 이 처리는 세라마이드 *I에서 DHS를 생성했습니다. PHS 및 X는 세라마이드 *II에서 생성되었습니다(그림 2D). 이러한 결과는 세라마이드-1(*I)이 DHS-Cer이고 세라마이드-2(*II)가 피토세라마이드와 X를 갖는 세라마이드의 복합체임을 보여준다. 세라마이드-1 및 -2 형성은 세라마이드 합성의 특정 억제제에 의해 차단되었으며, fumonisin B1(FuB)(그림 3B)(Merrill et al., 1993) 및 australifungin(미공개 데이터)(Mandala et al., 1995). FuB에 의한 억제는 세라마이드 합성이 세라미다아제의 역전이 아닌 지방 아실-CoA 의존적 반응을 기반으로 한다는 것을 보여줍니다(Mao et al., 2000a,b).

마이크로솜 막을 사용하는 이 시험관 내 시스템은 세라마이드 합성이 온도 의존적이며 ATP, 세포질 및 막 분획을 필요로 한다는 것을 보여주었습니다(그림 3B). 헥사코사노산(C26) 및 PI를 함유하는 리포솜이 반응 혼합물에서 생략되었을 때, IPC 합성에서 약간의 감소(18%)가 발견되었습니다. 우리는 또한 그것을 발견했습니다 N-에틸말레이미드(NEM)는 세라마이드 합성을 완전히 억제하여 NEM에 민감한 단백질 또는 화합물이 필요함을 시사합니다(미공개 데이터).

세라마이드 및 IPC 합성효소 활성은 각각 ER 및 Golgi 장치에 국한됩니다.

효모에서 세라마이드 합성 부위에 관한 증거는 발표되지 않았습니다. 그러나 IPC 합성효소 활성과 Aur1p는 골지체에 국한되어 있다(Levine et al., 2000). 따라서, 세라마이드의 수송을 조사하기 위해서는 세라마이드 합성 활성이 위치하는 위치를 정의하는 것이 중요했습니다. Aur1p-헤마글루티닌(HA)을 발현하는 [ 3 H]DHS 표지된 막의 자당 밀도 구배에 의한 세포내 분획화는 합성된 세라마이드와 DHS 및 DHS-1-P의 대부분이 ER 마커 Wbp1p로 거동하는 반면, IPC는 Aur1p-로 공동 침강되는 것으로 나타났습니다. 골지막에 대한 마커인 HA 및 Sed5(미공개 데이터 Banfield et al., 1994 Schröder et al., 1995 Levine et al., 2000). 이 결과는 각각 세라마이드 및 IPC 합성의 ER 및 골지 국소화를 시사한다.

다음으로 정제된 ER 및 Golgi가 풍부한 막을 사용하여 세라마이드와 IPC 합성을 재구성할 수 있는지 여부를 조사했습니다. ER이 풍부한 멤브레인은 이전에 설명한 대로 준비되었으며(Wuestehube and Schekman, 1992), Golgi가 풍부한 멤브레인은 차등 원심분리에 의해 분리되었습니다(재료 및 방법 참조). Western blotting 분석에 따르면 Wbp1p는 S27의 추가 분획으로 인해 P27 분획과 P45 분획에서 독점적으로 발견된 반면 Emp47p, Golgi 마커(Schröder et al., 1995) 및 Aur1p-HA는 최종 상청액(S45)에서 주로 발견되었습니다. ) (그림 4A). 따라서 이 분획에 소량의 ER 막이 남아 있음에도 불구하고 우리는 S45 분획을 골지 농축 막의 소스로 사용했습니다. 자당 구배에 대한 P27 분획의 분획화는 도 4B에 도시된 바와 같이 ER 막의 추가 정제(40/50% 자당 계면에서)를 초래하였다. 도 4C는 세라마이드 및 IPC 신타제 활성이 조사된 실험을 나타낸다 정제된 ER 및 Golgi가 풍부한 멤브레인으로 예상대로 효율적인 합성과 세라마이드의 IPC로의 후속 전환에는 ER 및 Golgi가 풍부한 막을 모두 추가해야 했습니다. 소포체 막만 배양한 경우 합성된 세라마이드의 양은 높게 유지되었지만(완전 배양의 87%), IPC 합성 수준은 낮았다. 이것은 IPC 신타제 활성이 골지막에 국한되어 있음을 확인시켜줍니다. 대조적으로, 골지막만을 첨가하면 세라마이드 및 IPC 합성이 각각 41% 및 27% 현저하게 감소되었습니다. 검출 가능한 양의 Wbp1p가 Golgi 막 분획에서 발견되었기 때문에 ceramide synthase 활성의 완전한 손실이 없는 것은 Golgi 분획의 ER 오염으로 인한 것일 가능성이 가장 높습니다. 위의 결과는 ER에 대한 세라마이드 합성의 국소화와 일치합니다. 그런 다음 세라마이드는 IPC로 전환하기 위해 골지체로 운반됩니다.

체외에서 세라마이드 수송의 특성

ER에서 Golgi 구획으로의 세라마이드 수송을 연구하기 위해 우리는 다음으로 세라마이드에서 IPC로의 전환을 기반으로 하는 2단계 시험관내 분석을 개발했습니다. 첫 번째 단계에서는 24°C에서 2시간 동안 세포질, ATP 재생 시스템, 기질 및 AbA가 있는 상태에서 ER이 풍부한 막을 배양하여 방사성 표지된 세라마이드를 합성합니다. ER이 풍부한 막을 사용한 [ 3 H]DHS로부터의 세라마이드 합성에는 ATP와 세포질도 필요하며 온도와 시간에 따라 달라집니다(미공개 데이터). AbA는 ER 분획에서 Golgi 막의 오염으로 인해 발생하는 모든 IPC 합성 효소 활성을 차단하는 데 사용되었습니다. 세라마이드 합성 후, ER 막을 원심분리(27,000 NS, 10분, 4℃). 방사성 표지된 세라마이드의 회수율은 >85%였습니다. 두 번째 단계에서 수용체 막 및 세포질, ATP 재생 시스템, 기질, AbA 및 FuB(추가 세라마이드 합성을 차단하기 위해)를 [ 3 H]세라마이드를 함유하는 ER 막 분획에 첨가했습니다. AbA-저항성 균주로부터 제조된 마이크로솜 막은 AbA-저항성이지만 야생형 세포가 생체내에서 AbA의 존재하에 IPC를 만들 수 있기 때문에 수용체 막으로 사용되었다(도 5A). AbA 내성 세포에서 제조된 마이크로솜 막은 AbA에 내성이 있지만 FuB에는 민감합니다(미공개 데이터). 도 5B는 시험관내 세라마이드 수송 분석의 기본 특징을 나타낸다. AbA 내성 균주의 수용체 막을 완전한 반응 혼합물에 사용했을 때, 세라마이드가 IPC로 전환되어 ER에서 골지막으로의 세라마이드 수송을 간접적으로 분석했습니다. 반응 혼합물에 남아 있는 세라마이드의 양은 4°C에서와 비교하여 24°C에서 배양 후 감소했습니다(미공개 데이터). 음성 대조군으로서, 야생형 균주의 수용체 막에서는 전환이 검출되지 않았다. 세라마이드에서 IPC로의 전환에는 세포질에 대한 강력한 요구 사항이 있었습니다. 반응은 15분의 지연으로 120분 동안 계속되었으며(그림 5C), 실험 및 준비에 따라 다릅니다(그림 7, A-C 참조). 4°C에서 세라마이드가 IPC로 전환되지 않기 때문에 반응은 온도 의존적이었습니다(미공개 데이터). ATP의 고갈은 세라마이드의 IPC로의 전환에 영향을 미치지 않았으며, 이는 세라마이드 수송이 ATP 독립적인 방식으로 우리 시스템에서 발생함을 시사합니다. 반응은 수용체 막의 양에 따라 달라지며, 수용체 막의 최대 ~50μg(단백질 농도)까지 선형입니다. (그림 5D). ER에서 Golgi로의 세라마이드 전달의 특이성을 테스트하기 위해 우리는 25μg의 수용막을 취하고 농도를 증가시키는 경쟁막을 추가했습니다. 전달이 특이적이면 야생형 세포(AbA 민감성)의 마이크로솜 막이 IPC 합성을 억제해야 합니다. 이것이 사실이었다(그림 5E). 세라마이드가 어떤 막으로 전달되면 미토콘드리아도 경쟁할 수 있어야 하지만 경쟁할 수 없습니다(그림 5E).

세포질은 세라마이드를 IPC로 전환하는 데 필요했기 때문에 우리는 다음으로 세포질 성분이 특이적이고 단백질성인지 여부를 테스트했습니다(표 I). BSA가 세포질을 대체할 수 없기 때문에 세포질 요구량이 구체적이었습니다. 또한, Triton X-100의 첨가는 세포질 요구량의 거의 완전한 손실을 초래하여 세포질은 세라마이드 수송에 필요하지만 IPC 합성효소 활성에는 필요하지 않음을 시사합니다. 트립신으로 처리되거나 95°C에서 15분 동안 처리된 Cytosol은 IPC로의 효율적인 전환을 지원하지 않았습니다. 이러한 결과는 열에 불안정하고 트립신에 민감한 세포질 단백질(들)이 세라마이드 수송에 필요함을 나타냅니다. 대조적으로, 트립신으로 공여체, 수용체 또는 두 막을 모두 처리하면 세라마이드가 IPC로 전환되는 억제 효과가 거의 없었지만 동일한 조건에서 트립신 처리로 Aur1p의 COOH 말단에서 HA 에피토프 태그가 완전히 제거되었습니다(미공개 데이터 ).

우리의 분석에서 세라마이드 수송이 ER-to-Golgi vesicular 수송을 필요로 하는지 여부를 결정하기 위해 다음 실험 세트를 수행했습니다. 시험관내 무세포 분석을 사용한 여러 연구에서 NEM 및 GTPγS와 같은 비가수분해성 GTP 유사체가 ER-to-Golgi-vesicular 수송을 억제하는 것으로 나타났습니다(Baker et al., 1990 Barlowe et al., 1994). 도 6A에서 볼 수 있는 바와 같이, GTPγS와 NEM 모두 세라마이드 수송에 대한 강력한 억제 효과를 나타내지 않았다.수송 반응의 비소포성 성질은 cytosol과 microsomal membrane을 사용하여 확인되었습니다. 초18 시험관 내에서 제한된 온도에서 ER 유래 소포를 골지로 전달하는 데 결함이 있는 돌연변이 세포(Muñiz et al., 2001). IPC의 형성은 허용(24°C) 및 제한(30 및 37°C) 온도에서 1단계 분석으로 모니터링되었습니다. 고온은 야생형과 야생형 모두에서 IPC 합성의 정도를 감소시켰지만 초18 추출물, 특별한 결함 없음 초18 돌연변이가 검출되었다(도 6B). 따라서, 우리의 결과는 ER에서 Golgi 구획으로의 세라마이드 수송이 비소포 수송에 의해 발생함을 보여줍니다.

막 사이의 비소포성 수송에 대한 두 가지 메커니즘이 가정되었습니다. 하나는 세포질을 통한 지질의 전달이고 다른 하나는 직접적인 막 접촉을 통한 지질의 전달입니다(McIntyre and Sleight, 1994 Trotter and Voelker, 1994). 전자는 반응 전반에 걸쳐 ER 및 Golgi 막 농도에 크게 의존해야 합니다. 그러나 예비 실험은 반응이 24°C에서 반응의 여러 시점에서 희석 독립적임을 시사했습니다. 따라서 수송이 일어나지 않는 4°C에서 기증자와 수용자 막을 함께 사전 인큐베이션한 후 희석이 세라마이드 수송에 미치는 영향을 조사했습니다. 도 7A는 상이한 사전 인큐베이션 조건에 따른 세라마이드 수송의 동역학을 보여준다. IPC 합성은 4°C에서 5분 동안 막을 미리 혼합한 후 희석에 영향을 받지 않았습니다. 대조 실험은 혼합 전에 멤브레인을 독립적으로 희석했을 때(0분 사전 배양), 세라마이드에서 IPC로의 시간 의존적 전환이 관찰되지 않음을 보여주었습니다(그림 7B). 따라서 두 개의 멤브레인이 4°C에서 사전 배양되면 IPC의 합성은 멤브레인에 대해 0차 반응입니다. 이것은 세라마이드 수송이 ER-Golgi 막 접촉을 통해 발생함을 강력하게 시사합니다. 또한, 우리는 기증자와 수용자 막을 세포질과 함께 4°C에서 미리 배양한 다음 세포질 없이 희석했을 때 세라마이드가 IPC로 효율적으로 전환되지 않는다는 것을 발견했으며(그림 7C), 이는 ER-Golgi 후에 세포질이 필요함을 보여줍니다. 막 접촉. 대조적으로, 세포질 없이 4°C에서 사전 배양 및 세포질로 후속 희석은 세라마이드의 IPC로의 전환에 영향을 미치지 않았습니다. 따라서 세포질은 ER-Golgi 막 접촉을 설정하기 위해 우리의 조건에서 필요하지 않습니다.

ATP의 고갈은 영향을 미치지 않습니다 SEC18- 생체 내에서 독립적인 세라마이드 수송

IPC 합성은 ER-to-Golgi vesicular 수송이 차단될 때 억제되더라도 여전히 계속됩니다. 비서 돌연변이 세포(그림 1, A 및 B). 우리의 시험관 내 결과는 비서-독립적인 IPC 합성은 세라마이드의 ATP-독립적 수송에 의해 매개된다(그림 5, B, C, 그림 6 A). [ 3 H]myo-inositol을 PI에 통합하는 것은 IPC에 통합하는 것보다 낮은 온도에서 일어나기 때문에(Puoti et al., 1991), 이 차이를 통해 ATP 고갈이 PI에 미치는 영향을 조사할 수 있었습니다. SEC18-내인적으로 합성된 세라마이드로부터 스핑고지질의 합성을 측정하는 실험에서 온전한 세포에서 독립적인 IPC 합성. 돌연변이 초18 세포를 1-3°C에서 45분 동안 [ 3 H]myo-inositol로 표지하고 NaF 및 NaN과 함께 추가로 인큐베이션했습니다.3 ATP 고갈을 허용하기 위해 1-3°C에서 10분 동안. 이어서, 세포를 37℃에서 30분 동안 추적하였다. 1–3°C의 펄스 동안 IPC/C가 거의 합성되지 않았습니다. 언제 초18 돌연변이 세포는 37°C에서 추적되었고, 대략 3배 더 많은 IPC/C가 생성되었습니다. IPC/C 합성의 이러한 증가는 ATP 고갈의 영향을 받지 않았습니다(그림 8). 우리는 비소포체에 의해 ER에서 골지체로 세라마이드가 수송된다는 결론을 내렸습니다.SEC18-독립적) 온전한 세포의 경로는 ATP를 필요로 하지 않으므로 이 과정은 우리가 시험관 내에서 재구성한 세라마이드 수송을 반영합니다.


문서 및 링크

  • 아파
  • 작가
  • 빕텍스
  • 하버드
  • 기준
  • RIS
  • 밴쿠버

연구 성과 : 저널에 기고 › 저널 기사 › 연구 › 피어 리뷰

T1 - 살아있는 세포에서 소포성 및 비소포성 스테롤 수송

T2 - endocytic 재활용 구획은 주요 스테롤 저장 소기관입니다.

N2 - 우리는 천연 형광성 콜레스테롤 유사체인 디히드로에르고스테롤(DHE)을 사용하여 살아있는 세포에서 스테롤의 세포내 수송을 조사했으며, 이는 콜레스테롤의 많은 특성을 모방하는 것으로 나타났습니다. methyl-β-cyclodextrin에 로드된 DHE를 사용하여 우리는 펄스 추적 연구에서 이 콜레스테롤 유사체를 따랐습니다. 정상 상태에서 DHE는 세포내이입 재활용 구획(ERC)의 마커인 트랜스페린(Tf)과 광범위하게 공동 국소화되고 ERC 형태가 변경된 세포에서 Tf와 함께 재분배됩니다. ERC-연관 단백질인 mRme-1(G429R)의 우성-음성 돌연변이의 발현은 DHE 및 Tf 수용체가 세포 표면으로 복귀하는 속도를 늦추는 결과를 초래합니다. [3H]콜레스테롤은 자당 밀도 구배에서 125I-Tf와 동일한 분획에서 발견되며, 이 분획은 특히 동일한 소기관에 양고추냉이 퍼옥시다제-접합 Tf의 존재를 기반으로 더 높은 밀도로 이동할 수 있습니다. Tf의 소포 수송 및 ERC로부터의 DHE 유출은 에너지 고갈된 세포에서 완전히 차단되는 반면, 원형질막에서 ERC로의 DHE 전달은 약간만 영향을 받습니다. [3H]콜레스테롤을 사용하여 수행된 생화학적 연구는 ERC로/로부터의 콜레스테롤 수송의 에너지 의존성이 DHE 수송과 유사함을 보여줍니다. 우리는 세포 내 콜레스테롤의 많은 부분이 ERC에 국한되어 있으며 이 풀이 세포 콜레스테롤 항상성을 유지하는 데 중요할 수 있다고 제안합니다.

AB - 우리는 천연 형광성 콜레스테롤 유사체인 디히드로에르고스테롤(DHE)을 사용하여 살아있는 세포에서 스테롤의 세포 내 수송을 조사했으며, 이는 콜레스테롤의 많은 특성을 모방하는 것으로 나타났습니다. 메틸-β-시클로덱스트린에 로드된 DHE를 사용하여 펄스 추적 연구에서 이 콜레스테롤 유사체를 따랐습니다. 정상 상태에서 DHE는 세포내이입 재활용 구획(ERC)의 마커인 트랜스페린(Tf)과 광범위하게 공동 국소화되고 ERC 형태가 변경된 세포에서 Tf와 함께 재분배됩니다. ERC-연관 단백질인 mRme-1(G429R)의 우성-음성 돌연변이의 발현은 DHE 및 Tf 수용체가 세포 표면으로 복귀하는 속도를 늦추게 합니다. [3H]콜레스테롤은 자당 밀도 구배에서 125I-Tf와 동일한 분획에서 발견되며, 이 분획은 특히 동일한 소기관에 양고추냉이 퍼옥시다제-접합 Tf의 존재를 기반으로 더 높은 밀도로 이동할 수 있습니다. Tf의 소포 수송 및 ERC로부터의 DHE 유출은 에너지 고갈된 세포에서 완전히 차단되는 반면, 원형질막에서 ERC로의 DHE 전달은 약간만 영향을 받습니다. [3H]콜레스테롤을 사용하여 수행된 생화학적 연구는 ERC로/로부터의 콜레스테롤 수송의 에너지 의존성이 DHE 수송과 유사함을 보여줍니다. 우리는 세포 내 콜레스테롤의 많은 부분이 ERC에 국한되어 있으며 이 풀이 세포 콜레스테롤 항상성을 유지하는 데 중요할 수 있다고 제안합니다.


비디오 보기: საზოგადოებრივი ტრანსპორტი (칠월 2022).


코멘트:

  1. Mubar

    이 기능은 모든 산업에서 작동하지 않습니다.

  2. Sigebert

    나는 위의 모든 것에 동의합니다. 문제에 대해 논의하려고 노력합시다.

  3. Crandall

    wonderfully, very helpful message



메시지 쓰기