정보

분자량 한계를 예측하는 표면 플라즈몬 공명(SPR)?

분자량 한계를 예측하는 표면 플라즈몬 공명(SPR)?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

단순히 LOD(검출 한계)와 다른 단백질 검출에 대한 감도를 기반으로 SPR 시스템이 검출할 수 있는 저분자량(LMW) 분석물을 예측할 수 있습니까? 그래서 지금 우리가 개발한 시스템은 약 5fg/ml의 LOD로 알파-시누클레인(14kDa)을 감지할 수 있습니다. LMW를 어떻게 감지할 수 있는지 예측할 수 있습니까? 참고문헌이나 그런게 있나요? 내가 아는 한 먼저 실험을 기반으로 RII의 변화를 얻을 수 있기 때문입니다. 하지만 지금 제 경우는 LMW를 감지하기 위해 SPR 장치의 한계를 테스트하고 싶습니다(지금 구매할 LMW 분석물을 선택하고 있습니다).

감사합니다! 모든 토론이나 의견은 매우 감사합니다


세포 생물학의 표면 플라즈몬 공명 센서: 기초 및 응용

표면 플라즈몬 공명(SPR) 센서라고 하는 표면 플라즈몬의 여기를 기반으로 하는 광학 센서는 수용체-리간드 접촉과 같은 다양한 거대분자 상호작용을 특성화하고 정량화하기 위한 중심 분석 도구가 되었습니다. 이러한 고전적인 응용 분야 외에도 지난 15년 동안 리간드/세포 또는 숙주/병원체 상호작용, 세포/세포 접촉 및 세포 반응의 탐지 및 분석을 목표로 하는 SPR 센서의 개발이 상당한 추진력을 얻었습니다. 필수 원핵 또는 진핵 세포를 의료 진단, 환경 모니터링 또는 생물학적 안전을 위한 생체 인식 요소로 구현하는 SPR 센서의 적용에 대해 보고하는 간행물의 수가 꾸준히 증가하고 있습니다. 이 리뷰는 표면 플라즈몬 공명 기술과 생명 세포 센서 분야에서의 응용에 중요한 매개변수에 대한 간략한 소개를 제공합니다. 또한, 세포외 및 세포내 자극에 대한 세포 상호작용 및 세포 반응 분석에서 이러한 센서의 적용에 관한 간행물이 요약되어 있습니다.

기관을 통해 액세스할 수 있는 구독 콘텐츠의 미리보기입니다.


추상적 인

작은 분자는 상업적으로 이용 가능한 표면 플라즈몬 공명(SPR) 기기를 사용하여 직접 검출하기 어렵습니다. 이는 저분자량 화합물이 굴절률의 측정 가능한 변화를 일으킬 만큼 충분한 질량을 갖지 않기 때문입니다. 그러나 굴절률은 분석물의 질량 이외의 다른 특성에 민감합니다. 최근에 SPR을 사용하여 고정된 단백질에 대한 실질적인 구조적 변화의 검출이 보고되었습니다. 그러나, 이 특성은 고정된 단백질 수용체에 결합하는 저분자량 리간드의 검출을 위해 아직 이용되지 않았습니다. 여기에서 우리는 고정된 말토오스 결합 단백질 및 조직 트랜스글루타미나제에 대한 작은 분자의 결합을 모니터링하기 위해 리간드 유도 구조적 변화를 사용할 수 있음을 보여줍니다. 유체역학적 반경이 감소하는 수용체에 대한 리간드 결합은 굴절률의 순 감소를 산출했습니다. 유체역학적 반경이 증가하는 수용체에 대해 굴절률의 순 양의 변화가 관찰되었습니다. 굴절률 변화는 표면에 분석물 분자 질량을 추가하는 것으로 설명할 수 없습니다. 이러한 SPR 반응은 반응의 가역성과 SPR 결정 평형 해리 상수와 보고된 해리 상수 사이의 유사성에 의해 판단되는 특정 수용체-리간드 상호작용의 결과였습니다. 또한, 이 기술은 소분자 패널에서 특정 리간드를 감지하는 데 효과적인 것으로 입증되었습니다. 이 SPR 방법은 널리 사용되는 상업적으로 이용 가능한 기기에 변경이 필요하지 않았지만 칼슘 이온(40 Da)과 같은 매우 작은 분자를 직접 검출할 수 있었습니다. 저분자량 ​​분석물을 검출하기 위한 수용체 형태의 사용은 저분자 약물 라이브러리의 고처리량 스크리닝 및 바이오센서 개발에 잠재적으로 응용할 수 있습니다.

현재 주소: University of WisconsinMadison, Madison, WI 53706 생화학과.

교신저자: (e-mail) [email protected] (팩스) 919-597-6400.


추상적 인

작은 분자는 상업적으로 이용 가능한 표면 플라즈몬 공명(SPR) 기기를 사용하여 직접 검출하기 어렵습니다. 이는 저분자량 화합물이 굴절률의 측정 가능한 변화를 일으킬 만큼 충분한 질량을 갖지 않기 때문입니다. 그러나 굴절률은 분석물의 질량 이외의 다른 특성에 민감합니다. 최근에 SPR을 사용하여 고정된 단백질에 대한 실질적인 구조적 변화의 검출이 보고되었습니다. 그러나, 이 특성은 고정된 단백질 수용체에 결합하는 저분자량 리간드의 검출을 위해 아직 이용되지 않았습니다. 여기에서 우리는 고정된 말토오스 결합 단백질 및 조직 트랜스글루타미나제에 대한 작은 분자의 결합을 모니터링하는 데 리간드 유도 구조적 변화를 사용할 수 있음을 보여줍니다. 유체역학적 반경이 감소하는 수용체에 대한 리간드 결합은 굴절률의 순 감소를 산출했습니다. 유체역학적 반경이 증가하는 수용체에 대해 굴절률의 순 양의 변화가 관찰되었습니다. 굴절률 변화는 표면에 분석물 분자 질량을 추가하는 것으로 설명할 수 없습니다. 이러한 SPR 반응은 반응의 가역성과 SPR 결정 평형 해리 상수와 보고된 해리 상수 사이의 유사성에 의해 판단되는 특정 수용체-리간드 상호작용의 결과였습니다. 또한, 이 기술은 소분자 패널에서 특정 리간드를 감지하는 데 효과적인 것으로 입증되었습니다. 이 SPR 방법은 널리 사용되고 상업적으로 이용 가능한 기기에 변경이 필요하지 않았지만 칼슘 이온(40 Da)과 같은 매우 작은 분자의 직접 검출이 가능했습니다. 저분자량 ​​분석물을 검출하기 위한 수용체 형태의 사용은 저분자 약물 라이브러리의 고처리량 스크리닝 및 바이오센서 개발에 잠재적으로 응용할 수 있습니다.

현재 주소: University of WisconsinMadison, Madison, WI 53706 생화학과.

교신저자: (e-mail) [email protected] (팩스) 919-597-6400.


재료 및 방법

샘플 수집 및 림프구 분리

혈액은 치료 후 치주염이 치유된 기증자(Centre for Oral Rehabilitation, Public Dental Health Care, County Council of Östergötland, Linkoping, Sweden)로부터 에틸렌디아민테트라아세트산(EDTA) 바이알(Venoject K2E, 벨기에 루벤)에 수집되었습니다. 전혈을 0.9% NaCl 용액에 1:1 비율로 희석하고 2개의 피콜 튜브(Thermofischer Scientific Inc., 스톡홀름, 스웨덴)에 있는 6.0mL의 림프프렙 용액(Axis-shield PoC, 노르웨이 오슬로)에 조심스럽게 층으로 쌓았습니다. 1800에서 구배 원심 분리 NS 20°C에서 20분 동안 명확하고 뚜렷한 림프구 층을 조심스럽게 피펫으로 제거하고 인산염 완충 식염수(PBS pH 7.2 Apoteket AB, Linkoping, Sweden)로 세척했습니다. 세포는 10% 소태아혈청(FBS Sigma-Aldrich, Stockholm, Sweden)이 보충된 l-글루타민(ATCC, Boras, Sweden)을 함유하는 1-15 배지에서 배양하고 37℃에서 밤새 인큐베이션하였다.

Linköping의 지역 윤리 위원회는 연구를 승인했으며(2010/307-31), 우리 연구에 참여한 모든 환자에게 동의를 얻었습니다.

세균 배양 및 림프구 자극

포르피로모나스 진기발리스 야생형 ATCC 33277(American Type Culture Collection, Manassas, VA), 야생형 W 50, E8(W50 파생 RgpA 결핍 및 RgpB 결핍) 및 K1A(W50 파생 Kgp 결핍)(Prof. MA Curtis, Molecular Pathogenesis Group, Queen Mary, University of London, UK), 야생형 381, DPG-3(381 파생 Fim A-결핍) 및 KRX-178(381 파생 Mfa-1-결핍)(친절하게 제공됨) RJ Genco 교수, Buffalo University, NY 미생물학 및 면역학과)는 혐기성 조건(80% N2, 10% CO2, 및 10% H2) 챔버에서 37°C(Concept 400 Anaerobic Workstation Ruskinn Technology Ltd., Leeds, UK). 박테리아를 세척하고 Krebs-Ringer 포도당 완충액(120mM NaCl, 4.9mM KCl, 1.2mM MgSO)에 재현탁했습니다.4, 1.7mM KH24, 8.3mM Na2HPO4및 10mM 글루코스, pH 7.3).

열처리 NS. 치은염 80°C에서 20분 동안 배양하여 준비했습니다. 총 10 μL의 열처리된 현탁액을 까다로운 혐기성 한천 플레이트에 펼쳐 박테리아가 사멸되도록 하고 37°C에서 5일 동안 인큐베이션했습니다. 열처리 NS. 치은염 ATCC 33277, 10 9 cfu/mL를 사용하여 림프구를 자극하고 37°C에서 배양했습니다. 21일까지 일정한 간격으로 신선한 배지를 보충하였다.

림프구의 유세포 분석

세포 구성을 연구하기 위해 유세포 분석을 수행했습니다. 세포를 300℃에서 원심분리 NS (Eppendorf Centrifuge 5702R5, Germany)에서 5분간 방치하고 상층액을 버리고 펠렛을 PBS 1000μL에 녹였다. 세포 조성은 100μL의 샘플을 20μL의 CD19, CD3, CD16/56 및 CD45 표면 마커와 함께 fluorochromes allophycocyanin(APC), fluorescein isothiocyanate(FITC), phycoerythrin(PE) 및 Peridinin chlorophyll protein complex (PerCP) (BD Biosciences, Stockholm, Sweden) 암실에서 15분간 배양. 450㎕의 용해 용액(2% 우태아 혈청(FCS Sigma-Aldrich, Stockholm, Sweden), PBS pH 7.4 중 0.1% 아지드화 나트륨 용액)을 첨가하여 적혈구를 용해시켰다. 15분의 인큐베이션 후, 세포를 BD FACS Canto(BD Biosciences, 스톡홀름, 스웨덴)에서 분석했습니다. 결과는 분석을 위해 CD45+ 림프구 세포를 게이팅함으로써 대수 규모로 플롯팅되었습니다. 세포는 박테리아로 자극한 지 1주 후에 분석된 반면, 자극되지 않은 세포는 3일 후에 분석되었습니다. 3일 후 자극되지 않은 림프구는 활성화제의 부재로 인해 추가 분석을 위한 충분한 세포 수를 포함하지 않았습니다. 따라서, 유동 세포 계측법 분석 3일 전에 앞서 설명한 바와 같이 동일한 환자의 혈액에서 림프구를 분리하고 배양했습니다.

면역형광 염색 및 공초점 현미경

배양 2주 및 3주에 의해 자극된 세포 현탁액을 170℃에서 원심분리하였다. NS, 펠렛을 10% FBS를 함유하는 새로운 l-15 배지 2mL에 용해시켰다. 그런 다음 총 200μL의 5 x 10 5 세포/mL 현탁액을 600rpm에서 6분 동안 세포 원심분리했습니다. 파라포름알데히드(4%)를 사용하여 실온에서 2시간 동안 세포를 고정시켰다. 고정된 세포를 PBS로 5분 간격으로 4회 세척하고, 5% FBS를 이용하여 상온에서 1시간 동안 블로킹한 후 동일한 프로토콜로 다시 세척하였다. 세포를 4℃에서 밤새 항-인간 CD38 항체(BD Biosciences, 스톡홀름, 스웨덴 희석 1:100)와 함께 인큐베이션하였다. 세포를 이전과 같이 PBS로 세척한 다음 플루오레세인 이소티오시아네이트 접합-염소 항-마우스 항체와 함께 실온에서 2시간 동안 인큐베이션하였다. 세포를 PBS로 4회 세척한 다음 4',6-diamidino-2-phenylindole(DAPI)(Sigma-Aldrich, Stockholm, Sweden)의 1:200 희석액으로 3분 동안 대조염색하였다. 4번 세척한 후, 세포를 LCM(laser-capture microdissection) Zeiss 공초점 현미경(스웨덴 Linköping University 병리과)에서 분석했습니다.

항체 회수

3주 후, 배양액을 멸균된 15mL 원심분리 튜브(Greiner Bio-One, Germany)에 옮기고 3500℃에서 원심분리하였다. NS 10분 동안 세포를 펠렛화합니다. 상층액은 0.45μm 멸균 필터(Thermofisher Scientific, Stockholm, Sweden)를 사용하여 여과하고 3500℃에서 100KDa Amicon 마이크로콘 컷오프 필터(Millipore, Molsheim, France)를 사용하여 원심분리했습니다. NS 60분 동안 에 대한 항체를 포함하는 상층액 NS. 치은염 분자량이 >100KDa인 것을 수집하고, 멸균물을 0.2μm 멸균 필터(Thermofisher Scientific, 스톡홀름, 스웨덴)로 여과하여 -50°C에서 보관하였다.

소듐도데실설페이트 폴리아크릴아마이드 겔 전기영동

표준 소듐도데실 설페이트 폴리아크릴아미드 겔 전기영동을 수행하여 항원에 대한 항체의 특이성을 보여주는 대안적 방법으로 항원-항체 상호작용을 시각화했습니다. 열처리 NS. 치은염숙주 림프구를 자극하는 데 사용된 ,NS. 치은염 시험관 내에서 생산된 항체와대장균 항체(Swed Diagnostics, 스톡홀름, 스웨덴).

준비된 모든 샘플을 PBS(pH 7.4, Sigma-Aldrich, Stockholm, Sweden)로 1:4 비율로 희석하고 3450℃에서 원심분리하였다. NS 배양 24시간 후 10분 동안. 상층액을 100KDa 원심분리 필터(Millipore, Stockholm, Sweden)에서 원심분리하고 동일한 부피의 Laemmli 완충액으로 5분 동안 가열했습니다. 샘플을 소듐도데실 설페이트 폴리아크릴아미드 겔 전기영동 TGX 프리캐스트 겔(Bio-rad, 스톡홀름, 스웨덴)에서 실행했습니다.

IgG 서브클래스 분석

ELISA 키트를 사용하여 시험관 내에서 생산된 항체에 대해 IgG 서브클래스 분석을 수행했습니다. 사전 코팅된 ELISA 플레이트 및 시약은 제조업체의 지침에 따라 준비되었습니다. 에 대해 생산된 시험관내 항체 NS. 치은염 ELISA 희석제로 1:4 비율로 희석했습니다. Peroxidase anti-human IgG 용액을 2차 항체로 사용하였고, 3,3',5,5'-tetramethylbenzidine 기질 용액을 chromogen 반응에 사용하였다. 결과는 ELISA 마이크로리더(Expert 96 ELISA 리더, GmBH, Austria)에 정지 용액을 첨가한 후 1시간 이내에 450 nm에서 판독되었습니다. 제조사에서 제공한 인간 혈청을 대조군으로 사용하였고, 농도는 표준물질로부터 계산하였다.

표면 플라즈몬 공명

안티NS. 치은염 아민 커플링 방법을 사용하여 특정 항원-항체 상호작용을 조사하기 위해 Biacore® 1000(GE Healthcare Ltd, 스웨덴)의 CM 5 센서 칩에 항체를 고정화했습니다. 고정은 세 단계로 수행되었습니다. 먼저 카르복시메틸화 덱스트란 코팅된 채널 표면을 칩에 주입하여 활성화했습니다. N-히드록시숙신이미드 및 N-에틸-N'디메틸아미노프로필카본아미드염산염(GE Healthcare Ltd, 스웨덴) 혼합물(1:1 비율). 안티NS. 치은염 항체는 주사 시 칩의 활성화된 표면에 결합하는 아세테이트(pH 4.5)로 희석되었습니다. 마지막으로 70 μL 에탄올아민(GE Healthcare Ltd, Sweden)을 주입하여 센서 표면을 비활성화하여 다른 입자가 센서 표면에 결합하는 것을 방지했습니다.

고정된 항체는 양성 및 음성 대조군을 실행하여 테스트했습니다. 항인간 IgG(Sigma-Aldrich, St Louis, MO) 및 가열 사멸 NS. 치은염 이전에 림프구를 자극하는 데 사용된 것을 양성 대조군으로 사용했습니다. 여러 ATCC 박테리아 균주(CCUG, 스웨덴 Gothenberg) 및 항 기니피그 IgG(Sigma-Aldrich)를 음성 대조군으로 사용했습니다. SPR로 얻은 반응은 Bia-evaluation 소프트웨어(GE Healthcare Ltd., 스웨덴)를 사용하여 RU에서 측정되었습니다.

감지 포르피로모나스 진기발리스 시험관 내 및 임상 샘플

건강한 혈액 기증자의 혈장 샘플을 수집하고 10 8 cfu/mL의 야생형 및 fimbriae 돌연변이와 함께 배양 NS. 치은염. 샘플을 PBS 7.4(Sigma-Aldrich, Stockholm, Sweden)에서 1:20으로 희석하고, 이들 세트를 항-NS. 치은염 밤새 항체. 항체 인큐베이션이 있거나 없는 샘플을 항-항체로 고정된 칩에서 실행했습니다.NS. 치은염 5 μL/min의 유속으로 항체.

환자로부터 GCF(gingival crevicular fluid) 샘플을 수집했습니다.N = 30) 스웨덴 린셰핑에 있는 구강재활센터 치주과에서 치료를 받지 않은 중증 치주염 환자와 연령 및 성별이 일치하는 치주적으로 건강한 대조군(N = 30).

샘플은 각 사분면의 가장 깊은 치주낭 또는 깊은 주머니가 없는 대조군의 모든 제1소구치의 근심 부위에서 얻었습니다. 치은 상부 플라크는 타액 오염 없이 제거되었고 치아는 공기 건조되도록 두었다. Periopaper 스트립을 치은연하 약 1-2mm 깊이로 삽입하여 GCF를 수집하고 스트립에 흡수된 GCF의 부피는 이전에 설명한 대로 보정된 Periotron 8000(Oraflow Inc, NY)을 사용하여 결정되었습니다(Chapple et al.., 1999). 환자당 4개의 페리오페이퍼 스트립의 GCF를 희석 완충제(Quantikine Human HGF 면역분석, R&D Systems, Minneapolis, MN)에 풀링하고 사용할 때까지 -20°C에서 동결했습니다.

샘플을 사용 전에 해동하고 멸균 PBS(Sigma-Aldrich, Stockholm, Sweden)로 1:20 비율로 희석했습니다. 샘플은 anti-NS. 치은염 5 μL/min의 유속으로 항체.

DNA-DNA 체커보드 혼성화 분석

치은연하 미생물 샘플은 GCF 샘플링과 동일한 4개 사이트에서 수집되었습니다. 치은연 플라그를 제거하고 치근 표면을 자연 건조시켰다. 세균 샘플은 치주 주머니에 삽입된 멸균 근관 페이퍼 포인트를 삽입하여 GCF를 20초 동안 수집한 동일한 4개 부위에서 치은하 세균 샘플을 수집하는 데 사용하고 멸균 시험관으로 옮겼습니다. 샘플은 스웨덴 예테보리 대학 구강미생물학 및 면역학과에서 처리되었으며 존재 여부를 분석했습니다. NS. 치은염, 최소 10,000개 세포의 검출 한계를 가진 DNA-DNA 체커보드 혼성화 기술을 사용합니다(Socransky et al.., 1994). 샘플은 이전 연구에도 포함되었습니다(Lonn et al., 2014 ).

실시간 중합효소 연쇄반응

Real-time PCR 분석을 수행하여 SPR 분석 방법의 검증을 수행했습니다. NS. 치은염 GCF 샘플에서 DNA-DNA 체커보드 분석 및 SPR 방법에서 다른 반응을 나타내는 샘플을 선택하고 건강한 대조군과 비교했습니다. NS. 치은염 TGTAGATGACTGATGTGTAAAACC의 16S rRNA 정방향 프라이머 서열과 ACGTCATCCCCACCTTCCTC의 역방향 프라이머 서열을 사용하였다. SYBR Green(Maxima® SYBR Green/ROX qPCR Master Mix, Fermentas, Sweden)을 사용하고 PCR 조건은 95°C에서 10분 동안 초기 변성 후 95°C에서 40주기 동안 15초로 설정한 다음 7900 HT 실시간 PCR 기기(Applied Biosystems)에서 60°C, 60초.

투과 전자 현미경

투과전자현미경을 이용하여 항염증제의 결합 친화도를 조사하였다.NS. 치은염 에게 NS. 치은염. NS. 치은염 PBS에서 1:20으로 희석된 용액을 항-NS. 치은염 PBS에서 1:100으로 희석된 항체. 과량의 항체는 PBS로 씻어내고 금표지된 항인간 IgG를 1:1000 비율로 첨가하였다(Nano Gold Probes, NY). 혼합물을 37℃에서 1시간 동안 인큐베이션하였다. 과량의 항체를 PBS로 세척하고 200μm 메쉬 폼바 코팅된 구리 그리드(Agar Scientific, Stansted, UK)에 장착할 때까지 1% 오스뮴 테트라옥사이드(Sigma-Aldrich, Stockholm, Sweden)로 고정했습니다. Uranyl acetate(2%, Sigma-Aldrich, Stockholm, Sweden)는 JEOL 1230 투과 전자 현미경(스웨덴 Linkoping University 병리과)에서 검사하기 전에 염색에 사용되었습니다.

통계 분석

Graph pad prism version 5.0(GraphPad Software, Inc. , 캘리포니아, 미국). 자유도 1에 대한 카이 제곱 분포 표와 NS > 0.05는 귀무 가설의 기각으로 간주되었으며(Fisher RAaY, 1963) 분석된 두 가지 방법으로 얻은 결과 간에 유의한 차이가 없었습니다.


분자량 한계를 예측하는 표면 플라즈몬 공명(SPR)? - 생물학

표면 플라즈몬 공명(SPR)은 금속-유전체 계면을 이동하는 표면 전자 밀도파에 에너지를 결합하도록 광자가 만들어지는 현상입니다. 커플링은 특정 에너지 및 운동량에서 발생하며, 집합적으로 공명 조건이라고 하며 반사된 빛의 딥(dip)을 유발합니다. 딥의 특성은 경계면에서 재료 속성의 함수이므로 딥을 모니터링하면 로컬 표면 환경에 대한 정보가 제공됩니다. 최근 몇 년 동안 소형화, 감도 증가, 높은 처리량 및 다중 모드 접근 방식을 향한 SPR 기술의 추진이 있었습니다. 이 논문은 SPR 바이오센서의 성능을 향상시키기 위한 두 가지 방법에 초점을 맞추고 있다. 첫째, 표면 플라즈몬 밴드갭 구조를 이용하여 SPR 감도를 향상시킨다. 이러한 밴드갭의 가장자리 근처에서 각도 심문 모드에서 SPR 바이오센서를 작동하면 동일한 조건에서 평평한 금속 표면의 SPR에 비해 감도가 6배 증가한다는 것이 여기에 표시됩니다. 둘째, 영상처리에 기반한 새로운 데이터 분석 기법을 이용하여 검출한계를 개선하는 방법을 제시한다. 다중 모드 표면 플라즈몬 질문 기술은 표면에서 분광 각도 분산의 2차원 이미지를 생성하는 데 사용되며, 이 이미지는 분광 각도 정보를 활용하기 위해 개발된 고유 벡터 분석 기법을 사용하여 표면 환경에 대한 정보를 추출하는 데 사용됩니다. DPM(Double Projection Method)으로 지정된 새로운 고유 벡터 기술을 사용하여 분광각 데이터에 대한 결과는 5x10-9 RIU(굴절률 단위)의 이론적 검출 한계로 넓은 동적 범위에 걸쳐 굴절률을 추정합니다. 현재 가장 높은 감도 단계 기반 방법. 실험 작업은 2x10-6 RIU의 달성된 분해능으로 실시간으로 저분자량 반응물(~400 Dalton)과의 생체 분자 상호 작용을 모니터링할 수 있는 DPM 방법을 보여줍니다.


표면 플라즈몬 공명 감지: 정제된 생체 분자에서 온전한 세포까지

표면 플라즈몬 공명(SPR)은 1980년대 최초의 SPR 기반 면역센서가 발명된 이후 생체분자 간의 결합 동역학을 측정하기 위한 잘 알려진 무표지 기술이 되었습니다. SPR 분석을 위한 가장 인기 있고 전통적인 형식은 리간드 분자를 포함하는 용액이 정제된 수용체 분자로 기능화된 센서 기판 위로 흐를 때 실시간 광 신호를 모니터링하는 것입니다. 최근 몇 년 동안 여러 종류의 SPR 이미징 기술의 급속한 발전으로 단일 살아있는 세포 내에서 국소 질량 밀도의 동적 분포를 높은 공간 및 시간 해상도와 신뢰할 수 있는 감도로 매핑할 수 있게 되었습니다. 이러한 기능은 중요한 생체 분자와 손상되지 않은 세포 사이의 상호 작용을 레이블이 없는 정량적 및 단일 세포 방식으로 즉시 조사할 수 있게 하여 세포 기반 SPR 생체 분석의 흥미로운 새로운 추세로 이어졌습니다. 이 트렌드 기사에서는 먼저 프리즘과 대물렌즈를 기반으로 하는 두 가지 유형의 SPR 이미징 기술의 원리와 기술적 특징에 대해 설명합니다. 그런 다음 우리는 기본적인 세포 생물학과 약물 발견 모두에서 온전한 세포 기반 응용 프로그램을 조사합니다. 우리는 미래 발전에 대한 의견과 관점으로 기사를 마무리합니다.

표면 플라즈몬 공명(SPR) 이미징 기술의 최근 발전으로 단일 살아있는 세포 내에서 무표지 매핑이 가능하여 정제된 생체 분자로 기능화된 균질 기질에서 개별 살아있는 세포를 포함하는 이종 기질에 대한 생체 분자 상호 작용 연구의 큰 확장으로 이어집니다.


고정된 파파인을 기반으로 하는 시스타틴 측정을 위한 표면 플라즈몬 공명 영상(SPRI) 센서

SPRI(Surface Plasmon Resonance Imaging) 센서는 시스타틴의 특정 측정을 위해 개발되었습니다. 센서에는 용액에서 시스타틴을 결합하는 고정된 파파인이 포함되어 있습니다. N-하이드록시숙신이미드(NHS)와 N-에틸-N-(3-디메틸아미노프로필)카보디이미드(EDC)로 활성화된 파파인은 아민으로 변형된 금 표면에 고정되었습니다. 시스테아민은 금 표면의 개질을 위해 사용되었습니다. 파파인 농도와 상호작용의 pH가 최적화되었습니다. 1.5 μg mL-1의 파파인 농도와 6.5의 pH가 최적으로 선택되었습니다. 상호작용의 특이성은 인간 알부민과의 상호작용의 결여에 의해 확인되었다. 센서의 동적 응답 범위는 0 ~ 0.6μg mL-1이고 검출 한계는 0.09μg mL-1입니다. 결과는 양호한 일치를 나타내는 PETIA(입자 강화 면역탁도 분석) 방법과 비교하여 검증되었습니다. 계란 흰자 시스타틴 또는 시스타틴 C의 검량선을 사용했습니다. 센서 잠재력을 입증하기 위해 혈장, 소변 및 타액에서 시스타틴 C가 측정되었으며, 이는 문헌에 보고된 데이터와 잘 일치함을 보여줍니다. 백혈병 환자의 혈장 내 시스타틴 농도에 대한 결과는 정상 수준의 시스타틴 미만인 것으로 나타났습니다.

단백질 및 펩티드 편지

제목: 고정된 파파인을 기반으로 하는 시스타틴 측정을 위한 표면 플라스몬 공명 영상(SPRI) 센서

용량: 18 문제: 1

저자:E. Gorodkiewicz 및 J. Luszczyn

입회:전기화학과, Bialystok 대학교 화학 연구소, Al.J.Pilsudskiego11/4, 15-443 Bialystok, Poland.

추상적 인: SPRI(Surface Plasmon Resonance Imaging) 센서는 시스타틴의 특정 측정을 위해 개발되었습니다. 센서에는 용액에서 시스타틴을 결합하는 고정된 파파인이 포함되어 있습니다. N-하이드록시숙신이미드(NHS)와 N-에틸-N-(3-디메틸아미노프로필)카보디이미드(EDC)로 활성화된 파파인은 아민으로 변형된 금 표면에 고정되었습니다. 시스테아민은 금 표면의 개질을 위해 사용되었습니다. 파파인 농도와 상호작용의 pH가 최적화되었습니다. 1.5 μg mL-1의 파파인 농도와 6.5의 pH가 최적으로 선택되었습니다. 상호작용의 특이성은 인간 알부민과의 상호작용의 결여에 의해 확인되었다. 센서의 동적 응답 범위는 0 ~ 0.6μg mL-1이고 검출 한계는 0.09μg mL-1입니다. 결과는 양호한 일치를 나타내는 PETIA(입자 강화 면역탁도 분석) 방법과 비교하여 검증되었습니다. 계란 흰자 시스타틴 또는 시스타틴 C의 검량선을 사용했습니다. 센서 잠재력을 입증하기 위해 혈장, 소변 및 타액에서 시스타틴 C가 측정되었으며, 이는 문헌에 보고된 데이터와 잘 일치함을 보여줍니다. 백혈병 환자의 혈장 내 시스타틴 농도에 대한 결과는 정상 수준의 시스타틴 미만인 것으로 나타났습니다.


결과 및 논의

인플루엔자 A 바이러스 및 실리카 나노입자의 SPRM 이미징.

그림 2NS 다양한 크기의 실리카 나노입자와 H1N1 인플루엔자 A 바이러스의 SPRM 이미지를 보여줍니다. SPR 이미지는 표면에 민감하기 때문에 표면에 있거나 표면에 매우 가까운 입자만 볼 수 있습니다. 인플루엔자 A 바이러스 입자의 크기는 문헌에 따라 90~110nm입니다(4). 실리카 나노 입자는 또한 현미경의 회절 한계보다 작아 투과 이미지에서 보이지 않습니다. 바이러스 및 실리카 나노입자의 SPR 이미지는 흥미로운 V자형 회절 패턴이 있는 밝은 점으로 표시됩니다. 이러한 패턴은 나노입자에 의한 표면 플라즈몬 파동의 산란에 기인한 것으로, 이에 대해서는 추후 자세히 설명한다.

(NS) H1N1 인플루엔자 A 바이러스 및 PBS 완충액에서 3가지 크기의 실리카 나노입자의 SPRM 이미지. (삽입) 수치 시뮬레이션에 의해 생성된 나노입자 이미지. (NS 그리고 ) X 및 Y 방향을 따라 선택된 입자의 SPR 강도 프로파일( NS, 각각. (삽입) 시뮬레이션된 이미지의 해당 프로필.

공간 해상도.

그림 2 NS 그리고 선택된 바이러스 및 실리카 나노입자의 이미지 강도 프로파일을 각각 (Y) 및 (X) 표면 플라스몬 전파 방향에 수직으로 보여줍니다(그림 2에서 점선으로 표시)NS). 입자의 크기에 관계없이 수직 방향 프로파일은 광학 회절 한계로 인한 약 0.5 μm의 반치폭(FWHM)을 나타냅니다. 632nm 레이저와 NA 1.65 대물렌즈를 사용하는 현미경의 이론적인 회절 한계는 0.23μm이며, 두 숫자의 차이는 입사 레이저 빔이 설정에서 대물렌즈의 전체 조리개를 완전히 덮지 않아 결과적으로 더 작은 유효 개구수(그림 1). 표면 플라즈몬 전파 방향을 따른 강도 프로파일은 강도가 약 3μm의 감쇠 길이로 감쇠한다는 것을 보여줍니다. 강도 감쇠는 표면 플라즈몬 파동의 유한 전파 길이를 측정합니다(그림 2) 금속의 종류와 입사광의 파장에 따라 다릅니다. 예를 들어, 532nm 빛을 사용하는 경우 전파 길이는 회절 한계(16)에 가까운 수중 금의 경우 약 0.2μm로 줄어듭니다. 광학 시스템의 간섭 패턴으로 인한 강도의 진동은 종종 관찰되지만 현미경의 x 또는 y 변환과 함께 이동하지 않으며 실제 샘플 형상에서 쉽게 분리될 수 있습니다.

SPRM 실험 설정의 개략도(축소하지 않은 도면). 설정에 대한 자세한 설명은 재료 및 방법.

회절 패턴.

개별 입자와 관련된 회절 패턴은 배경 소음 및 간섭 패턴에서 나노 입자를 식별하는 데 도움이 됩니다. 수치적으로 시뮬레이션된 나노 입자의 SPRM 이미지(그림 2NS 삽입) 패턴이 표면 플라즈몬 파동의 나노 입자 유도 산란으로 인한 것임을 확인합니다. 계산된 라인 프로파일(그림 2 NS 그리고 삽입) 측정된 프로파일과 잘 일치합니다. 또한 회절 패턴의 계산된 피크 강도는 입자 크기에 따라 증가하며 이는 실험 데이터와도 일치합니다.

바이러스-표면 상호작용.

시간이 지남에 따라 입자 이미지를 추적하여 다양한 유형의 바이러스-표면 상호 작용을 구별할 수 있습니다. 우리는 베어 골드, PEG 기능 표면 및 항인플루엔자 기능 표면의 세 가지 다른 표면에서 인플루엔자 바이러스의 SPRM 이미지를 얻었습니다. 그림 3NS 금에 인플루엔자 A 입자의 SPRM 이미지의 시간 순서를 보여줍니다. 이 시퀀스의 비디오(Movie S1)를 사용할 수 있습니다. 금 표면에 바이러스 입자의 접착은 바이러스 용액을 완충 용액에 스파이킹한 직후 관찰할 수 있습니다. 이에 반해 실리카 나노입자는 표면에 달라붙지 않고 브라운 운동으로 인해 영상에서 나타났다가 사라진다(동영상 S2 참조).

베어 골드에 인플루엔자 A 바이러스의 SPRM 이미지. (NS) 인플루엔자 바이러스의 SPRM 이미지 시퀀스. 컬러 맵은 상대 SPR 이미지 강도를 mDeg로 표시합니다. (NS) SPR 강도는 개별 바이러스 입자가 금 표면에 흡착되는 영역(사각형으로 표시)에서 시간이 지남에 따라 이동합니다.

그림 3NS 3개의 대표적인 바이러스 입자의 평균 강도를 보여줍니다(그림 3에서 점선 직사각형으로 표시됨).NS) 맨 골드 표면에 시간이 지남에 따라. 바이러스 입자가 SPRM 이미지에 나타나는 순간은 화살표로 표시됩니다. 바이러스 입자가 표면에 닿으면 표면에 머무르며 이는 바이러스 입자가 금에 강력하고 비가역적인 비특이적 흡착을 나타냅니다.

대조적으로, 바이러스는 PEG 및 항체 코팅된 표면에서 상당히 다르게 행동합니다. 그림 4NS 두 표면의 개별 인플루엔자 A 바이러스 입자에 대한 시간 경과에 따른 전형적인 SPRM 강도 프로파일을 보여줍니다. On the PEG-functionalized surface, the individual viral particles are imaged only as transient events—they appear and disappear rapidly, which is completely different from the behavior on the bare gold surface. This observation is expected because PEG coating is well known for its capability to block nonspecific binding of biomolecules to surfaces. The transient appearance and disappearance of the viral particles on the PEG-coated surface is due to Brownian motion. On the antibody-functionalized surface, the behavior of the viral particles is in between the two limits described above. We observed that individual viral particles tended to stay on the surface for much longer time than on the PEG-coated surface, but they eventually leave the surface. This observation can be attributed to a reversible binding of the viral particles to the antibody-coated surface.

(NS) SPR intensity vs. time profiles for influenza A viral particles on PEG and antiinfluenza A antibody-functionalized surfaces. (NS) Histogram showing relative binding probabilities of influenza A on PEG and antiinfluenza A antibody-functionalized surfaces. The analysis of control experiment, HCMV on antiinfluenza A antibody-functionalized surfaces, is also shown for comparison. Note the vertical axis of the histogram is the probability of a particle stays on the surface (determined from the time profiles similar to NS).

By tracking the individual viral particles in the SPRM image over time, we obtain the probabilities of individual influenza particles staying on the PEG and antiinfluenza-coated surfaces (Fig. 4NS). For comparison, the statistical analysis of human cytomegalovirus (HCMV) on the antiinfluenza antibody-coated surface is also plotted in Fig. 4NS. The histogram clearly shows that the specific binding of influenza A on the antibody-coated surface is significantly higher than the nonspecific bindings in the two control experiments, influenza A on the control PEG surface and the control virus, HCMV, on the antibody surface.

The single virus detection with our SPRM was carried out in a static solution, but the findings are consistent with those obtained with the conventional flow-through SPR measurement using samples with the same concentrations (Fig. S1). For example, the injection of 0.1 ml of 0.05 mg/ml influenza A solutions at a flow rate of 30 μl/ min resulted in a large irreversible binding of the virus on the bare gold chip, which is due to strong nonspecific interactions between influenza A and gold surface. On a PEG-functionalized chip, no virus binding was detected by the flow-through SPR. On an antibody-coated chip, approximately 45 mDeg SPR angular shift was observed, which is in between the two extremes. Finally, the flow-through SPR detected no significant binding of HCMV (0.25 mg/ml) onto the antiinfluenza A-coated chip.

Quantitative Analysis of Influenza A Size and Mass.

Mass is a fundamental physical parameter of substances, and precise measurement of mass is one of the most important analytical methods, such as mass spectroscopy (17). A widely used method to measure virus mass is based on ultracentrifugation, which determines the averaged mass of virus in a sample from density gradient sedimentation (18, 19). SPR measures the optical mass of each viral particle, which is directly related to the inertia mass of the particle. To determine the mass of influenza virus, we used silica nanoparticles with a refractive index of 1.46 as calibration standard. The refractive index of influenza based on its protein and lipid contents is approximately 1.48, close to that of the silica nanoparticles. Dry influenza consists of 70 to 75% proteins and 20 to 24% lipids (20), and the mass density of hydrated influenza virus is 1.19 g/ml (20, 21). At such a mass density, the refractive index of a protein solution is 1.48 (22), and the refractive index of lipids is similar (23). Based on these considerations, the refractive index of influenza virus was taken to be 1.48.

We measured the intensities of the individual nanoparticles from the SPRM images and constructed histograms for silica nanoparticles and influenza viral particles (Fig. 5NS). The histograms of the silica nanoparticles can be approximately fit with Gaussian distributions, but a small peak appears at an intensity twice of the main peak in each histogram (arrows in Fig. 5NS). We attributed it to the formation of nanoparticle dimers. 그림 5NS plots the relative SPRM intensity at the peak of each histogram vs. silica nanoparticle volume determined from the size and density provided by the manufacturers for each particle sample (Table S1). The intensity of a nanoparticle is expected to be proportional to the volume of the particle exposed in the evanescent field associated with the propagating surface plamsons. By considering that the evanescent field decays exponentially with distance from the surface, we express the intensity with [1] where 케이 is a constant (fitting parameter), is distance above the gold surface, NS is radius of the particle, and is the decay constant of the evanescent field, which is approximately 200 nm. Eq. 1 provides a good fit to the experimental data shown in Fig. 5NS (solid line).

(NS) Histograms of relative SPR intensity distributions of individual silica nanoparticles and influenza A viral particles. The solid red lines are Gaussian fittings of the distributions. Arrows indicate peaks that are likely due to the formation of dimmers. (NS) Calibration curve of SPR intensity plotted vs. particle volumes. The average volume of an influenza particle is obtained from the calibration curve and the average SPR intensity in the histogram plotted in A. The vertical error bars are standard deviations of the Gaussian fittings of the histograms of the SPR intensities. The horizontal error bars for the silica nanoparticles are standard deviations calculated from the coefficient of variation of particle diameter given by the manufacturers, and the horizontal error bars for the influenza are estimated from the standard deviation of the volume extracted from the SPR intensity.

From the calibration curve shown in Fig. 5NS and the histogram in Fig. 5NS, the volume and diameter of influenza A were found to be 6.8 ± 3.0 × 10 -4 μm 3 and 109 ± 13 nm, respectively. Given that the mass density of influenza A is 1.19 g/ml (19), the mass of influenza A virus was determined to be 0.80 ± 0.35 fg, which is in good agreement with the literature values (4, 20, 21) (see SI 부록 for details).

Using the same method, we also obtained the histogram of SPRM image intensity for HCMV viral particles (Fig. S2). Using the calibration curve in Fig. 5NS, we find that the average volume and diameter of a HCMV viron are 5.4 ± 0.7 × 10 -3 μm 3 and 218 ± 10 nm (assuming the refractive index of HCMV is 1.48), respectively, which are in consistent with the literature (approximately 230 nm diameter) (24). Using a reported density of 1.219 g/ml (25), we calculated that the mass of each HCMV viron is 6.5 ± 0.8 fg.

Detection Limit.

Fig. S3 shows the noise level of current setup. The noise level for an area covering a single particle image (∼3 × 5 μm) is 0.3 mDeg. Most SPR detections have time resolution of about one second. Using a one-second moving average, we can reduce the noise to 0.04 mDeg. This noise level, according to the calibration curve in Fig. 5, can detect 13 nm nanoparticles, corresponding to a detectable mass of approximately 1 × 10 -18 g (1 ag).

A more useful way to define the detection limit is detectable mass per unit sensing area, because it is directly related to the detectable analyte concentration in solution, an important quantity for most applications. This detection limit definition also allows one to compare sensors with different sensing areas. For instance, a small sensor may have a lower total mass detection limit, but its small sensing area makes it less likely to detect the analyte molecules. For our current SPRM setup, the entire image area is the sensing area, which is 0.08 × 0.06 mm 2 , so the binding of a single particle with mass as small as 1 ag on the sensing area can be detected. In terms of mass per unit area, the achieved detection limit is 0.2 fg/mm 2 , which is nearly four orders of magnitude better than the typical detection limit of the conventional SPR (15). This improved detection limit is provided by our capability of imaging single viral particles, which allows us to average signals in the regions of viral particles only so that noises in all other regions do not affect the signals of the particles. We note that further improvement in the detection limit may be achieved by using less noisy light source and CCD and by reducing mechanical vibrations of the system.


Biophysics uses biophysical instrumentation to characterize macromolecules in solution and study molecular interactions. The platform uses mass spectrometry for protein identification and small molecule identification and quantification and performs quality control of recombinant proteins for optimized data quality in downstream applications.

The platform ensures proper instrument function with routine maintenance and checks for high standards of performance.

As an active member of the ARBRE-MOBIEU EU network, a cluster of biophysics facilities across Europe, the platform contributes to improving information exchange, development and evaluation of new technologies.

  • State of the art instrumentation UV-VIS spectrophotometer: Protein/nucleic acid quantification. Enzyme kinetics.
  • Circular Dichroism (CD): Information about secondary structure and protein stability.
  • Fluorescence Spectroscopy (FS): Binding studies.
  • Differential Scanning Fluorimetry (DSF): Thermal stability of globular proteins. Protein quality controls (optimal buffers for downstream applications, storage conditions).
  • Dynamic Light Scattering (DLS): Sizes and distributions of biomolecules in solution.
  • Size Exclusion Chromatography coupled to Multi-Angle Light Scattering (SEC-MALS): Absolute molar mass determination.
  • MicroScale Thermophoresis (MST): Measurement of binding interactions.
  • Isothermal Titration Calorimetry (ITC): Thermodynamic technique to study different binding events.
  • Surface Plasmon Resonance (SPR): Measurement of biomolecular interactions in real time.Provides kinetic information (k~에 그리고 koff rates). Screening of low molecular weight analytes.
  • Mass spectrometer (ESI-TOF MS).: Protein identification. Small molecule identification and quantification.



코멘트:

  1. Melmaran

    나는이 생각이 유용 할 것입니다

  2. Totaur

    어떤 과학.

  3. Aleeyah

    매우 유용한 메시지

  4. Ramses

    고마워요, 읽으 러 갔어요.

  5. Brakinos

    그래 ... 인생은 자전거를 타는 것과 같습니다. 균형을 유지하려면 움직여야합니다.

  6. Farid

    아주 우연의 일치

  7. Goshicage

    당신을 대신하여 사회자의 도움을 구했을 것입니다.



메시지 쓰기