정보

단백질의 ATP 결합 영역과 하전된 삼인산의 상호 작용

단백질의 ATP 결합 영역과 하전된 삼인산의 상호 작용


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

DNA-히스톤 상호작용은 당-인산염 백본의 음으로 하전된 인산염을 중화시키는 양전하를 띤 아미노산 측쇄 그룹을 포함합니다. 단백질의 ATP 결합 부위도 마찬가지입니까?

내가 본 대부분의 모델에서 염기인 아데닌이 결합에 관여하는 것처럼 보입니다. 그러나 삼인산은 양전하를 띤 측쇄에 특이적으로 결합하는 것처럼 보입니다. 구글링을 조금 해보았지만 실제로 이것을 묘사한 모델을 찾을 수 없었습니다. 이것이 그러한지 아는 사람이 있습니까?


요약

뉴클레오티드 삼인산 ATP와 GTP에 결합하는 많은 단백질에는 분자의 인산염 부분에 결합하는 진화적으로 보존된 모티프인 P 루프가 있습니다. 이것은 GGXXXGKS/T 시퀀스를 가지고 있습니다. 보존된 염기성 라이신(K)은 양전하를 띤 두 개의 인산염 모이어티와 상호 작용하지만 다른 상호 작용에는 Mg가 포함됩니다.2+ 이온(NTP와 항상 복합체를 형성함) 및 전하를 띠기 보다는 극성인 아미노산 잔기 및 폴리펩타이드 백본.

상세한 일러스트레이션

질문이 ATP에 대해 묻지만 저는 GTP 결합 단백질 H-를 선택했습니다.라스 Pai의 논문 때문에 삽화로 p21 et al. 그것을 설명하면 ATP와 GTP에 대해 본질적으로 동일한 인산염의 상호 작용에 대한 자세한 내용을 제공합니다. (많은 다른 논문들은 단백질의 리본 다이어그램만을 보여주는 경향이 있습니다.) 또한 결정 구조는 필연적으로 GTP 유사체 GppNp와 복합체를 이룬다는 점에 주목하십시오. (GppNp는 GTP 자체와 달리 빠르게 가수분해되지 않습니다.)

이 경우 인산염에 결합하는 진화적으로 보존된 P 루프는 다음과 같은 순서를 갖습니다.

Gly Ala Gly Gly Val Gly Lys Ser 10 11 12 13 14 15 16 17

포스페이트 결합 영역의 3차원 표현은 아래와 같습니다. 왼쪽 프레임은 뉴클레오티드가 없는 P-루프와 잔기 Thr35 및 Asp57을 보여줍니다. 오른쪽 프레임은 동일하지만 GppNp와 마그네슘 이온이 포함되어 있으며 P 루프의 보존된 잔기만 표시되어 있습니다.

[Pai et al. Jmol 소프트웨어 및 Protein Data Bank 파일 5p21.pdb 사용]

상호 작용의 2차원 개략도가 아래에 나와 있습니다. 측쇄 상호 작용(및 마그네슘 이온의 상호 작용)은 빨간색 점선으로 표시되는 반면 백본의 상호 작용은 검은색으로 표시됩니다. P-루프의 보존된 잔류물은 파란색 텍스트로 표시됩니다.

[물 상호작용과 원자간 거리를 제외하고 Pai et al.이 논문의 그림 5의 일부를 단순화하여 다시 그렸습니다.]

반사

비록 양전하를 띤 염기성 아미노산 측쇄가 핵산과 뉴클레오티드 포스페이트의 음전하를 중화하는 데 관여하지만 이것이 유일한 수단은 아니며 NTP의 경우 주요 수단이 아닙니다. 마그네슘 이온과 극성 잔기(단백질 골격 δ+ve NH 그룹 포함)가 중요한 역할을 할 수 있습니다. 내 생각에 이것은 두 가지를 반영합니다. 첫째, 삶은 역동적입니다. 그래서 더 약한 상호 작용은 쉽게 분해되고 생성될 수 있기 때문에 효소에서 종종 선호됩니다. (NDP는 가수분해 후에 효소에서 방출되어야 합니다.) 두 번째로, 더 추측적으로 P-loop는 보존된 다양한 NTP-결합 단백질에서 발견되기 때문에 매우 오래된 것으로 생각됩니다. 이 상호 작용을 용이하게 하는 특정 백본 형태가 확인되었습니다. 유전 암호에 의해 지정된 모든 20(ish) 단백질이 발생하기 전에, 단백질 백본이 소분자와 상호작용하는 데 더 큰 역할을 할 수 있었을 때 발생했을 수 있습니다. (이것은 철-황 클러스터에서 δ+ve 황을 결합하는 백본 NH 그룹에 대해서도 제안되었습니다.)


ATP 결합 카세트 트랜스포터

NS ATP 결합 카세트 트랜스포터 (ABC 트랜스포터)는 가장 크고 아마도 가장 오래된 유전자 패밀리 중 하나인 수송 시스템 슈퍼패밀리입니다. 그것은 원핵 생물에서 인간에 이르기까지 현존하는 모든 문에 나타납니다. [1] [2] [3]

ABC 수송체는 종종 여러 소단위로 구성되며, 그 중 하나 또는 두 개는 막횡단 단백질이고 그 중 하나 또는 두 개는 막 관련 AAA ATPase입니다. ATPase 소단위는 ATP(adenosine triphosphate) 결합 및 가수분해의 에너지를 이용하여 기질의 흡수 또는 방출을 위해 막을 가로질러 기질의 전위에 필요한 에너지를 제공합니다.

대부분의 흡수 시스템에는 용질 결합 단백질인 세포질외 수용체도 있습니다. 일부 상동 ATPase는 RNA 번역 및 DNA 복구와 같은 비수송 관련 과정에서 기능합니다. [4] [5] ABC 트랜스포터는 전체 막 단백질이 독립적으로 여러 번 진화한 것처럼 보이지만 ATP-결합 카세트(ABC) 도메인의 서열 및 조직의 유사성을 기반으로 하여 ABC ​​슈퍼패밀리로 간주됩니다. 따라서 다른 단백질 패밀리를 포함합니다. [6] ABC 수출업자와 마찬가지로 ABC 흡수 시스템의 통합 막 단백질도 고해상도 3차원 구조를 기반으로 독립적으로 최소 3번 진화했을 가능성이 있습니다. ABC 섭취 포터는 다양한 영양소, 생합성 전구체, 미량 금속 및 비타민을 섭취하는 반면, 수출업자는 지질, 스테롤, 약물, 다양한 1차 및 2차 대사산물을 운송합니다. 인간의 이러한 수출업자 중 일부는 종양 내성, 낭포성 섬유증 및 기타 다양한 유전적 인간 질병에 관여합니다. 원핵생물과 진핵생물(인간 포함) 모두에서 이러한 수출자를 암호화하는 유전자의 높은 수준의 발현은 항생제 및 항암제와 같은 여러 약물에 대한 내성을 발생시킵니다.

수백 개의 ABC 트랜스포터가 원핵생물과 진핵생물 모두에서 특성화되었습니다. [8] ABC 유전자는 세포의 많은 과정에 필수적이며 인간 유전자의 돌연변이는 여러 인간 유전 질환을 유발하거나 기여합니다. [9] 48개의 ABC 유전자가 인간에서 보고되었습니다. 이들 중 많은 것들이 낭포성 섬유증, 부신백질이영양증, 스타가르트병, 약물 내성 종양, 듀빈-존슨 증후군, 바일러병, 진행성 친숙 간내 담즙정체, X-연관 철모세포종과 같은 인간에게 존재하는 질병과 인과 관계가 있는 것으로 특징화되고 밝혀졌습니다. 빈혈, 운동실조, 지속성 고인슐리민성 저혈당. [8] ABC 트랜스포터는 다중 약물 내성에도 관여하며, 이것이 이들 중 일부가 처음 확인된 방법입니다. ABC 수송 단백질이 암세포에서 과발현되면 항암제를 내보내고 종양에 내성을 갖게 할 수 있습니다. [10]


재료 및 방법

가교 기질의 준비

pS-protA 예비단백질을 코딩하는 플라스미드 pET21b-pS-protA는 이전에 기술된 바와 같이 구성되었다(Schnell and Blobel, 1993). pFd-protA-1을 암호화하는 플라스미드 pET21b-pFd-protA-1은 pFd 암호화 영역에 다음과 같은 변화를 도입한 프라이머를 사용하여 pET-pFd-protA(Ma et al., 1996)의 PCR 유도 돌연변이 유발에 의해 생성되었습니다. 위치 -1에서 시스테인으로 전환 및 위치 +4에서 글루타메이트-페닐알라닌 삽입. 나머지 pFd-protA-1 서열은 pFd-protA와 동일하였다(Ma et al., 1996). pS-protA-1을 인코딩하는 플라스미드 pET21b-pS-protA-1은 위치 -1의 시스테인을 세린으로 변경하기 위해 pET21b-pS-protA의 PCR 유도 돌연변이 유발에 의해 생성되었습니다. pS-protA-1 서열의 나머지는 pS-protA와 동일하였다. pS-protA-2를 인코딩하는 플라스미드 pET21b-pS-protA-2는 다음과 같은 변화를 도입한 프라이머를 사용하여 pET21b-pS-protA-1의 PCR 유도 돌연변이 유발에 의해 생성되었습니다: 위치 +39에서 발린에서 글루타메이트로의 전환 및 제거 위치 +41의 시스테인. 나머지 pS-protA-2 서열은 pS-protA-1과 동일하였다.

pS-protA, pS-protA-1, pS-protA-2 및 pFd-protA-1 폴리펩티드는 대장균 6개의 히스티딘 잔기의 COOH 말단 확장을 포함하는 BL21(DE3). 공급자의 권장 사항(Novagen, Inc., Madison, WI)에 따라 니켈-킬레이트 매트릭스에서 친화성 크로마토그래피에 의해 추출물에서 전단백질을 정제했습니다.

이종이작용성 가교제의 요오드화, N-[4[(NS-아지도살리실아미도)부틸]-3'(2-피리딜디티오)프로피온아미드(APDP Pierce, Inc., Rockford, IL) 및 [125I]APDP와 예비단백질의 커플링은 이전에 설명한 대로 수행되었습니다(Ma et al., 1996). 각 전단백질에 대한 [ 125 I]APDP 대 시스테인 잔기의 몰비는 모든 커플링 반응에서 1.5:1이었다. 가교 기질은 0.1M NaHCO에서 -80°C에서 보관되었습니다.3, pH 9.0, 8M 요소 함유.

엽록체 분리 및 분획화

온전한 엽록체는 10~14일 된 완두콩 묘목에서 분리되었습니다(피숨 사티붐 (Pain and Blobel, 1987) 균질화 및 Percoll 실리카 겔 구배 원심분리에 의한 변형 Green Arrow. 분리된 엽록체를 50mM Hepes-KOH, pH 7.7, 0.33M 소르비톨(HS 완충액)에 2 내지 3mg 엽록소/ml에 해당하는 농도로 재현탁시켰다.

엽록체 외피막을 제조하기 위해, 온전한 엽록체는 고장성 조건에서 용해되었고 Keegstra와 Yousif(1986)에 의해 기술된 바와 같이 차등 원심분리에 의해 가용성 및 막 분획으로 분리되었습니다. 총 막 분획은 이전에 기술된 바와 같이 선형 자당 구배로 부유에 의해 외피 및 틸라코이드 막 분획으로 분리되었다(Schnell et al., 1994).

전구체 결합 및 가교 반응

분리된 온전한 엽록체는 내인성 ATP를 고갈시키기 위해 어둠 속에서 26°C에서 15분 동안 400nM 니제리신의 존재 하에 50mM KOAc, 4mM MgOAc(수입 완충액)를 함유하는 HS 완충액에서 배양되었습니다. 모든 결합 반응은 1 ml의 반응 부피에서 2 mg 엽록소에 해당하는 엽록체를 사용하여 암실에서 수행되었습니다. ATP가 없는 상태에서 전구체의 결합(에너지 독립 결합)을 위해 ATP 고갈 반응 동안 20U의 아피라제(Sigma Chemical Co., St. Louis, MO)를 엽록체 현탁액에 첨가하였다. ATP(조기 수입 중간체) 존재 하에 전구체의 결합을 위해 ATP가 고갈된 엽록체를 0.1mM MgATP 및 0.1mM MgGTP의 존재하에 26°C에서 5분 동안 인큐베이션했습니다. 수입 반응을 위해 ATP가 고갈된 엽록체를 2mM MgATP의 존재하에 26°C에서 5분 동안 배양했습니다. 전처리 후 urea-denatured preprotein을 최종 농도가 200nM이 되도록 첨가하고 26°C에서 10분(energy-independent binding and early import middle) 또는 20분(late import stage) 동안 배양을 계속했습니다. 엽록체를 얼음 위의 유리 페트리 접시의 아래쪽 절반으로 옮기고 위에서부터 312 nm의 chromato-vu transilluminator(UVP, Inc., Upland, CA)로 5 cm의 거리에서 일정한 흔들림으로 20분 동안 조사했습니다. . 온전한 엽록체의 써모리신 처리는 얼음 위에서 30분 동안 0.1mg 써모리신/ml를 사용하여 이전에 설명한 대로(Cline et al., 1984) 수행되었습니다. 엽록체를 6,000℃에서 30초 동안 원심분리하여 수집했습니다. NS 미세원심분리기에서 전술한 바와 같이 분획화하고, 외피 분획을 SDS-PAGE로 분석하였다.

시료 분석 및 정량

모든 가교된 샘플은 12% 폴리아크릴아미드 겔에서 SDS-PAGE로 분해되었습니다. 건조된 젤의 방사성 신호는 IPLab 젤 과학 이미지 처리 버전 1.5c 프로그램(Signal Analytics, Vienna, VA)과 함께 Phosphorimager SI(Molecular Dynamics, Inc., Sunnyvale, CA)를 사용하여 캡처되고 정량화되었습니다. 방사성 겔의 모든 이미지는 IP Labgel 소프트웨어를 사용하여 캡처되었습니다. Canvas 버전 2.1 소프트웨어(Deneba Systems, Inc., Miami, FL)를 사용하여 이미지 레이블을 추가하고 XLS 8600 PS 프린터(Kodak, Rochester, NY)에서 이미지를 인쇄했습니다.


재료 및 방법

융합 단백질의 클로닝 및 부위 지정 돌연변이 유발

인간의 코딩 시퀀스 HMGA1a 5' ATGAGTGAGTCGAGCTCGAAGTCCAGC 3' 및 5' ACTGCTCCCTCCTCCGAGGACTCC 3'(Interactiva) 프라이머를 사용하여 2μl 역전사된 HepG2 RNA에서 PCR 증폭되었습니다. 이 제품과 다른 모든 PCR 제품은 제조업체 지침(Invitrogen)에 따라 TOPO™TA 클로닝에 의해 서브클로닝되었습니다. HMGA1 cDNA는 다음과 같습니다. 에코또는 pEGFPN1(Clontech)에 삽입된 RI.

인간 HMGA1a의 부위 지정 돌연변이유발은 본질적으로 QuickChange® 부위 지정 돌연변이유발 키트 프로토콜(Stratagene)에 설명된 대로 수행되었습니다. hHMGA1a 인산화 부위의 돌연변이를 위해, 다른 곳에서 보고된 바와 같이 hHMGA1a 단백질 서열의 위치 21(T21A), 53(T53A) 및 78(T78A)에서 아미노산 트레오닌을 코딩하는 뉴클레오티드에 알라닌 코돈 치환이 도입되었습니다(Siino et al. , 1995).

AT-후크 점 돌연변이는 위치 28(R28G), 60(R60G) 및 86(R86G)에서 보존된 AT-후크 모티프 PRGRP의 중심 글리신 코돈 다음에 아르기닌 코돈의 글리신 치환에 의해 도입되었습니다. 다음 프라이머 (서모 Hybaid)을 각각 PCR 반응에 사용되었다 : R28G 5 'CGGGGCCGGGGCGGGCCGCGCAAGCAG 3'R28G 5 'CTGCTTGCGCGGCCCGCCCCGGCCCCG 3'R60G 5 'CCTAAGAGACCTCGGGGCGGACCAAAGGGAAGC 3'R60G 역방향 5 'GCTTCCCTTTGGTCCGCCCCGAGGTCTCTTAGG 3'R86G 5 'GGAAGGAAACCAAGGGGCGGACCCAAAAAACTGGAG 3'R86G 역방향 역방향 5' CTCCAGTTTTTTGGGTCCGCCCCTTGGTTTCCTTCC 3'. 돌연변이 조합이 순차적으로 이루어졌습니다. 파생된 클론은 시퀀싱에 의해 확인되었습니다.

형질전환 및 세포 처리

HepG2 세포는 이펙텐(Quiagen) 및 제조업체가 지정한 400ng의 플라스미드 DNA를 사용하여 일시적으로 형질감염되었습니다. 형질감염된 세포는 37°C 및 5% CO에서 하룻밤 동안 커버슬립에서 성장했습니다.2 50% 합류까지. 형질감염율은 적어도 50%, 그러나 통상적으로 약 60% 이상이었다. HMGA1a-GFP의 발현은 여러 세포 주기에 걸친 세포 성장을 방해하지 않았습니다. 염색질 아세틸화를 위해 세포를 500ng/ml Trichostatin A(TSA, Calbiochem)와 함께 2시간 동안 인큐베이션했습니다. 로스코비틴(25μM, Calbiochem)을 4시간 동안 인큐베이션하였다. 단백질 키나제 C에 대한 세포 투과성 특이적 억제제인 ​​미리스토일-Phe-Ala-Arg-Lys-Gly-Ala-Leu-Arg-Gln-OH(ICN Biomedicals)를 4시간 동안 10㎍/ml로 사용했습니다.

살아있는 세포 이미징 및 FRAP 분석

살아있는 세포 이미징을 위해 세포는 배양 배지가 있는 슬라이드 챔버에 장착된 커버슬립에서 성장했습니다. 세포는 Leica TCS-SP를 사용하여 실온에서 다음 20-30분 이내에 분석되었습니다. 37°C, 5% CO에서 FRAP 실험2 이제 실온에서 얻은 것과 비교하여 회수 동역학의 차이를 보여주었습니다(표시되지 않음). 세포는 Ar/Kr 레이저의 GFP용 488 nm 레이저 라인을 사용하여 분석되었습니다(488 nm: 18 mW 공칭 출력, 1 568 nm에서 핀홀 설정: 17 mW 공칭 출력, 1에서 핀홀 설정, ×40 neofluar 대물렌즈, NA 1.25). 표백을 위해 하나의 단일 스캔을 획득한 다음 이미징 없이 반경 약 1μm의 스폿을 사용하여 1초의 단일 표백 펄스를 획득했습니다. 이미징을 위해 레이저 출력을 표백제 강도의 4%로 감쇠했습니다. 그런 다음 단일 섹션 이미지를 1초 간격(20개 이미지), 2초 간격(10개 이미지), 5초 간격(10개 이미지) 및 10초 간격(20개 이미지)으로 수집했습니다. 유사분열 세포에서 염색체 움직임을 감소시키기 위해 10 μM 탁솔 존재하에서 FRAP 실험을 수행하였다. 이미징 중 평균 형광 손실은 2-3%였습니다. FRAP 회복 곡선은 Phair와 Misteli(Phair and Misteli, 2000)에 따라 배경을 뺀 그림에서 생성되었습니다. 정량적 값은 세 번의 독립적인 실험에서 얻은 최소 10개 세포의 평균을 나타냅니다. 표준으로 GFP, H3-GFP 및 고정 세포를 사용했습니다. 검출기 시스템에서 전자 노이즈의 기여로 인해 일부 복구가 100%보다 큰 것으로 관찰되었습니다. 재학생 NS- 테스트는 결과의 통계적 유의성을 결정하는 데 사용되었습니다.

형광현미경 및 천연염색체 확산

Hoechst 33258을 사용한 DNA 대조염색의 경우, 형질감염된 세포를 0.1% Triton으로 1분 동안 간단히 투과화한 다음 실온에서 PBS 중 2% 포름알데히드에 10분 동안 고정했습니다. 그 다음, 세포를 실온에서 10분 동안 PBS 중 100 ㎕ 0,1% Triton X-100으로 투과화시키고 Hoechst 33258을 500 ng/ml의 최종 농도로 첨가하였다. 세포를 세척하고 설명된 대로 Mowiol에 장착했습니다(Hock et al., 1998). Hoechst 염색 세포는 Kr/Ar 레이저(Zeiss 510)의 364 nm 레이저 라인을 사용하거나 Pixera 디지털 시스템이 장착된 Zeiss Axiohot에서 공초점 레이저 스캐닝 현미경으로 조사되었습니다. 포름알데히드 고정 세포에 대한 면역형광 절차는 본질적으로 이전에 설명한 대로였습니다(Hock et al., 1998). 면역형광 실험에 사용된 1차 항체는 항-HMGA1(Ray Reeves의 선물), 항-sc35(희석액 1:2000 Sigma) 및 항히스톤 H1(희석액 1:20 ICN)이었습니다. 고유 염색체의 확산은 본질적으로 설명된 대로였습니다(Christensen et al., 2002).

DNA 염색, 전사 및 제자리 염 추출 실행

Hoechst를 사용한 제자리 DNA-염색을 위해, 형질감염된 세포를 10㎍/ml Hoechst를 함유하는 PBS 중 0.05% Triton X-100으로 투과화시켰다. 세포를 2-5분 동안 인큐베이션하고 즉시 모니터링했습니다. Hoechst에 더 오래 노출되면 HMGA1a-GFP가 변위되었습니다.

In situ run-on 전사는 이전에 설명한 대로 수행되었습니다(Hock et al., 1998). BrUTP 통합 후, 세포는 위에서 설명한 대로 고정되고 투과화되었습니다. 통합 BrUTP는 항-BrdUTP(Roche, Mannheim, 1:25 희석)를 사용하여 검출되었습니다. 광학 섹션은 0.8에서 핀홀 설정 및 35%에서 488 nm에 대한 AOTF 및 50%에서 568 nm에 대한 AOTF가 있는 x40 neofluar oil-immersion 대물렌즈(N.A. 1.25)를 사용하여 Leica TCS-SP로 기록되었습니다. GFP 및 Texas-red의 형광 신호가 동시에 기록되었습니다. 이색 사진은 병렬로 기록되었습니다. 누화는 관찰되지 않았다.

제자리 염 추출을 위해 커버슬립에서 성장한 세포를 PBS에서 두 번 세척하고 3ml 세포골격 완충액[CSK 100mM NaCl, 300mM 자당, 10mM Pipes, pH 6.8, 3mM MgCl2, 0.5% Triton X-100, 1mM PMSF, Leupetin, Pepstatin, Bestatin 및 RNasin(MBI)] 4°C에서 10분 동안.CSK를 피펫팅으로 제거하고 세포를 2% 포름알데히드에 고정하거나 4°C에서 5분 동안 350mM NaCl과 함께 3ml CSK에서 염 추출을 위해 추가로 인큐베이션하거나 소화 완충액[CSK와 유사하지만 50mM NaCl 및 20U/ml RNasin(MBI) 및 200U/ml DNase I(Roche)] 실온에서 30분 동안. 그런 다음 세포를 고정하고 위에서 설명한 대로 면역형광 분석을 위해 처리했습니다.

전자현미경

초미세구조 수준에서 HMGA1a-GFP의 국소화는 3㎍/ml의 GFP(Roche)에 대한 단일클론 항체와 12nm 금 입자(Dianova, 희석 1)에 결합된 이차 항체를 사용하여 이전에 설명한 대로 본질적으로 수행되었습니다(Hock et al., 1998). :10).

Western Blot 분석 및 단백질 염 추출

HMGA1a-GFP 융합 단백질의 염 추출 특성을 테스트하기 위해, HepG2 세포를 인간 HMGA1a-GFP 또는 대조군으로 GFP로 형질감염시키고, PBS로 2회 세척한 다음, 0.5% Triton X-100을 함유하는 PBS 또는 350mM 염을 함유하는 PBS로 인큐베이션하였다. 및 실온에서 10분 동안 0.5% Triton X-100. 상층액을 수집하고 용해시켰다. 얼음처럼 차가운 아세톤으로 단백질을 침전시켰다. 침전된 단백질을 70% 아세톤으로 2회 세척하고 공기 건조하고 SDS 샘플 완충액에 재현탁시켰다.

SDS-PAGE 및 니트로셀룰로오스로의 전이는 이전에 설명한 대로 수행되었습니다(Hock et al., 1998). 면역블롯에 대한 1차 항체의 희석은 항-GFP(Roche)의 경우 0.2㎍/ml, 항-HMGA1a(Santa Cruz)의 경우 0.5㎍/ml, 항-pep2의 경우 0.3㎍/ml(Hock et al., 1998)이었다. 액틴에 대한 단일클론 항체(Gonsior et al., 1999)는 1:1000의 희석으로 사용되었습니다. 차단 및 인큐베이션은 HMGA1 항체를 제외하고 실온에서 1시간 동안 5% 무지방 분유/TBS에서 수행되었으며, 차단은 TBS + 0.1% Tween-20에서 수행되었습니다. 설명된 대로 세척 및 검출을 수행했습니다.


재료 및 방법

축산.

이 연구는 University of Washington Institutional Animal Care and Use Committee의 검토 및 승인을 받았습니다. 36~37개월 된 수컷 CB6F1(BL/6: BalbC) 마우스를 국립노화연구소(National Institute of Aging)의 노화된 마우스 콜로니로부터 받았습니다. 모든 마우스는 14/10 명암 주기로 21°C에서 유지되었고 실험 절차 전후에 편차 없이 표준 마우스 음식과 물을 임의로 제공했습니다. 마취 없이 경추 탈구로 동물을 죽였습니다.

조직 추출, 미토콘드리아 분리 및 SS-31 치료.

동물을 죽이는 날 심장(120~150mg 습중량)을 절제했습니다. 전체 심장은 2mL의 얼음처럼 차가운 호흡 완충액(RB, 1mM EGTA, 5mM MgCl2, 105mM K-MES, 30mM KCl, 10mM KH)에서 유리 Dounce 균질화기의 얼음 위에서 균질화되었습니다.24, pH 7.1). 균질물을 800 x에서 10분 동안 원심분리했습니다. NS 4 °C에서 상등액을 수집하고 8,000 ~ 10,000 x에서 15분 동안 원심분리했습니다. NS 4 °C에서 상층액을 제거한 후, 펠렛을 분리 배지에 재현탁시켰다. 펠렛을 8,000~10,000x에서 15분 동안 원심분리했습니다. NS 4 °C에서 분리 배지에 재현탁합니다. 미토콘드리아 펠릿을 새로운 원심분리기 튜브로 분리하고 200μL RB, 10mM 피루베이트 및 2mM 말레이트로 희석했습니다. elamipretide 또는 2 μL 식염수를 미토콘드리아에 첨가하고 실온에서 1시간 동안 가볍게 흔들면서 인큐베이션했습니다.

생체 외 및 생체 내 기능 분석.

미토콘드리아 호흡과 H2영형2 생산은 10 μM bSS-31의 존재 또는 부재 하에 위에서 설명한 바와 같이 젊은(5-7개월) 및 노인(36-37개월) 마우스 심장 또는 비복근 근육에서 분리된 미토콘드리아에서 분석되었습니다. , Oxygraph 2K 이중 호흡계/형광계(Oroboros Instruments) 사용. 생체 내 ADP 민감도를 평가하기 위해 우리는 Siegel et al.의 데이터를 재분석했습니다. (30). 미토콘드리아 과산화물은 라이카 SP8X 공초점 현미경을 사용하여 mitoSOX 대 mitoTrackerGreen의 비율로 정량화되었습니다. 이러한 분석에 대한 자세한 내용은 SI 부록, SI 재료 및 방법.

가교 반응.

가교제 아미드-DP-NHP( SI 부록, SI 재료 및 방법)를 bSS-31과 함께 배양된 미토콘드리아에 10mM의 최종 농도(270-mM 스톡 용액으로부터)로 첨가하였다. 반응 혼합물을 실온에서 30분 동안 800rpm으로 혼합하였다. bSS-31과 함께 배양된 마우스 심장 미토콘드리아의 4가지 생물학적 복제물 및 bSS-31이 첨가되지 않은 음성 대조군 샘플을 포함하여 총 5개의 가교 샘플이 생성되었습니다. 가교 후 샘플은 -80 °C에서 동결되었습니다.

가교 미토콘드리아 샘플 준비.

가교된 미토콘드리아 샘플은 0.1M NH에서 8M 요소로 용해되었습니다.4HCO3. 추출된 단백질은 트립신으로 분해되었고 bSS-31 가교 펩타이드는 에 자세히 설명된 바와 같이 모노머 아비딘으로 풍부했습니다 SI 부록, SI 방법 및 재료.

가교 펩티드 쌍의 LC-MS 분석.

교차 결합된 펩티드 쌍의 분석을 위해 개발된 두 가지 방법, 즉 ReACT(33) 및 Mango(34)를 사용하여 LC-MS로 샘플을 분석했습니다. ReACT 분석은 Waters nanoAcquity UPLC(초고성능 액체 크로마토그래피)와 결합된 Velos-FTICR(푸리에 변환 이온 사이클로트론 공명) 질량 분석기에서 수행되었습니다.

Thermo Easy nLC와 결합된 Thermo Q-exactive plus 질량 분석기를 사용하여 Mango에서 샘플을 분석했습니다. 보다 SI 부록, SI 재료 및 방법 LC-MS에 대한 자세한 내용은

데이터 분석.

.RAW 형식의 LC-MS 데이터 파일은 Trans Proteomic Pipeline 소프트웨어 제품군(93)의 ReADW 도구를 사용하여 .mzXML 형식으로 변환되었습니다. Comet(94)은 bSS-31(Biotin-D-Arg- 디메틸 Tyr-Lys-Phe-NH2). 자세한 내용은 참조 SI 부록, SI 재료 및 방법.

분자 도킹.

bSS-31에 대한 분자 모델은 Avogadro(v. 1.2.0)를 사용하여 1,000개의 컨포머에 대한 분자 역학 컨포머 검색 ​​후 기하학적 최적화를 사용하여 생성되었습니다. PatchDock(35)는 bSS-31 상호작용 단백질(AATM = PDB: 3pdb, ADT c-state = PDB: 2c3e, ADT m-state = PDB: 6gci)에 대한 PDB의 구조 모델과 bSS-31 모델을 도킹하는 데 사용되었습니다. , ATPA/ATPB = PDB: 5ARA, QCR2/QCR6 = PDB: 1sqp, NDUA4 = PDB: 5z62, ECHA = PDB: 6dv2, IDHP = PDB: 5h3f 및 KCRS = PDB: 1crk). Clustal Omega(36)는 각 마우스 단백질을 다른 종의 상동 구조와 정렬하는 데 사용되었습니다. 각 단백질에 대해 PatchDock의 상위 10개 점수 도킹 모델을 다운로드했으며 bSS-31과의 상호 작용 인터페이스는 bSS-31의 원자 위치를 캡슐화하는 표면 부피의 5Å 이내의 아미노산 잔기로 정의되었습니다.

데이터 가용성.

이 문서에 제시된 모든 비오틴화된 SS-31 교차 연결 데이터는 데이터베이스 XLinkDB(xlinkdb.gs.washington.edu/xlinkdb/BiotinylatedSS31_Bruce.php)에서 사용할 수 있습니다. LC-MS 데이터는 PRIDE 아카이브(https://www.ebi.ac.uk/pride/archive)에 수탁 번호 PXD019484.


COV 상호 작용에 관여하는 인간 DDX 헬리카제의 구조적 개요

인간 DDX 헬리카제는 슈퍼패밀리 2(SF2) 헬리카제 중 가장 큰 패밀리인 DEAD-box 단백질 패밀리에 속합니다(Byrd and Raney, 2012). 그들은 유연한 링커 영역을 통해 연결된 두 개의 RecA 유사 도메인(D1 및 D2)으로 구성된 고도로 보존된 헬리카제 코어를 공유합니다(Hilbert et al., 2009). DEAD 도메인 및 헬리카제 도메인으로도 알려진 이 두 도메인은 9개의 보존된 모티프, Q, 1, 1a, 1b, II, III, IV, V 및 VI의 존재와 공통 테트라펩티드(Asp-Glu -Ala-Asp) 모티브 II(그림 5A). 많은 DEAD 상자 헬리카제에서 D1D2 도메인은 길이가 몇 백 개에서 수백 개에 이르는 별개의 측면 영역 또는 보조 도메인에 연결됩니다(Rudolph and Klostermeier, 2015). 이러한 가변 N-말단 및 C-말단 도메인은 이 단백질 패밀리의 기능적 다양성에 기여하고, 단백질 또는 RNA 상호작용을 통해 또는 헬리카제 코어의 활성을 조절함으로써 개별 헬리카제를 표적으로 안내합니다(Del Campo and Lambowitz, 2009 Mallam et al., 2011 Ferrage et al., 2012 Rudolph 및 Klostermeier, 2015). 표 2, 3에 보고된 DDX 헬리카제에 대한 구조 연구는 주로 헬리카제 코어 또는 분리된 보조 도메인에 초점을 맞추고 있으며, 전체 길이 헬리카제의 구조가 거의 없습니다. 그럼에도 불구하고 헬리카제 코어의 보존된 패치는 활동에 대한 중요한 통찰력을 제공합니다. DDX 단백질에서 두 개의 RecA 유사 도메인은 모두 RNA 결합과 ATP 가수분해를 담당합니다(Hilbert et al., 2009). 구체적으로, 보존된 모티프 Q, I(P-루프), II 및 VI는 ATP 결합에 참여하고 가수분해 모티프 III는 NTP 가수분해를 핵산 해제에 연결하는 역할을 하고 모티프 Ia, Ib, IV 및 V는 RNA 결합(그림 5)(Hilbert et al., 2009).

그림 5. (A) DDX 헬리카제의 일반적인 도메인 구성. 모티브는 주요 기능(빨간색, ATP 결합 및 가수분해 노란색, NTP와 RNA 결합 부위 사이의 배위 파란색, RNA 결합)에 따라 색상으로 표시됩니다. (NS) RNA가 없는 DEAD-box 단백질 eIF4AIII(왼쪽) 및 RNA와 복합체(오른쪽)의 RNA 결합 시 DDX 헬리카제의 도메인 움직임을 보여주는 만화 표현. RNA 단편과 AMPPNP는 각각 녹색과 청록색의 스틱 표현으로 표시됩니다.

표 2. DALI로 계산한 SARS-CoV-2 Nsp13과 인간 DDX 헬리카제의 구조적 유사성.


단백질 기능을 실행하기 위한 알로스테리의 에너지 재분배

단백질의 한 부위에서 섭동이 일어나면 멀리 떨어진 부위에 영향을 미칠 수 있습니다. "알로스테릭 효과"라고 ​​하는 이 중요한 생물학적 현상은 단백질 조절 및 세포 신호 전달에 필수적이며 세포 기능에서 중요한 역할을 합니다. 그것의 근본적인 기능적 중요성은 알로스테리가 어떻게 작동하는지 이해하는 것을 목표로 하는 수많은 연구에 영감을 주었습니다. 알로스터리는 크거나 관찰되지 않은 미묘한(주로 측쇄) 형태 변화를 수반할 수 있습니다(1). 구조적 변화는 엔탈피에 의해 주도됩니다. "동적 알로스테리"라는 용어는 1980년대 초 Cooper와 Dryden에 의해 "거대분자 형태 변화가 없는 경우에도" 알로스테리를 설명하기 위해 만들어졌습니다(2). Cooper와 Dryden은 동적 알로스테리가 주로 엔트로피 효과라고 주장했습니다. 그러나 저자가 그러한 변화를 관찰하지 않았기 때문에 구조적 변화가 전혀 없음을 암시하는 "동적 알로스터리"를 취하는 지난 20년 동안 수많은 작업이 출판되었습니다(1). 중요한 것은, 관찰 가능한 형태적 변화가 없는 "동적 알로스테리"는 알로스테릭(기능적) 상태에 유리한 새로운 에너지 재분배가 엔트로피, 엔탈피 또는 둘 다에 의해 지배되는 두 "고유한" 상태 사이의 인구 이동에 의해 여전히 지배된다는 것입니다. 엔탈피가 동적 알로스테리에서도 역할을 하는지에 대해 의문을 제기한 연구는 거의 없습니다(1). PNAS에서 Kumawat와 Chakrabarty(3)는 실제로 동적 알로스테리에서도 엔탈피가 섭동 시 잔류물 사이에서 내부 에너지, 특히 정전기 상호작용 에너지를 재분배하는 역할을 한다는 것을 보여줍니다(그림 1).

PDZ3 도메인 단백질에서 동적 알로스테리의 정전기적 기초 계획. 동적 알로스테리는 구조적 변화가 크지 않습니다. 펩타이드(CRIPT)가 결합하면 엔탈피 변화는 크지 않지만 Kumawat와 Chakrabarty(3)는 정전기 에너지의 재분배를 보고했습니다. 이러한 재분배는 단백질이 기능을 실행하도록 다른 PDZ 도메인으로 전파될 수 있습니다.

정전기는 기능에서 확고한 플레이어입니다. 수십 년 전 Warshel(4) 및 Warshel et al. (5) 단백질 촉매에서 중요한 역할을 하고 알로스테에서 페루츠(6)에서 중요한 역할을 입증했습니다. 최근에, 형태적으로 구동되는 알로스터리(7, 8)에 대해 정전기 네트워크의 재배열이 보고되었습니다. PNAS의 동적 알로스테리에서 숨겨진 정전기적 상호작용에 대한 보고서(3)는 정전기적 상호작용 에너지의 재분배가 상당한 구조적 변화가 있든 없든 알로스테릭 단백질에서 보편적일 수 있다고 주장합니다.

단백질은 기능을 실행하기 위해 정전기 상호작용 에너지의 재분배를 수용합니다. 예를 들어, 운동 단백질인 미오신은 음전하를 띤 ATP에 결합하여 정전기적 결합 네트워크를 재분배하여 액틴 결합 부위의 전하를 변경하여 액틴에서 미오신이 해리됩니다(7). 따라서 미오신은 알로스테리에서 정전기 상호작용 에너지를 재분배하여 액틴으로부터 해리 기능을 실행합니다.

PDZ 도메인 단백질은 잘 알려진 세포 신호 단백질이다. PDZ 도메인의 주요 기능은 수백 개의 수용체 및 이온 채널 단백질의 무질서한 C-말단 펩티드 모티프의 인식, 다른 모듈 도메인과의 이량체화 및 인지질 결합을 포함합니다. 세포 신호의 동적 조절자로서 PDZ 기능은 알로스테릭하게 조절될 수 있습니다(9). PDZ3 도메인 단백질에서 펩타이드 인식 부위는 소수성 β2-α2 영역에 위치합니다. PDZ3 도메인의 말단 잔기의 돌연변이 또는 말단 α3 나선(10)의 결실은 상당한 구조적 변화를 일으키지 않고 인식 부위의 결합 친화도에 알로스테릭하게 영향을 미칩니다. 대조적으로, 인식 부위에서 펩티드의 결합은 비록 여전히 큰 형태적 변화는 없지만 PDZ3 도메인의 역학을 변화시킨다. 분자 역학 시뮬레이션과 단백질 상호 작용 에너지 분석을 사용하여 Kumawat와 Chakrabarty(3)는 β2-α2 영역에서 펩타이드 결합의 섭동이 특정 전하를 띤 잔기의 측쇄 재배열을 유도하여 새로운 유리한 정전기적 상호 작용을 형성함을 보여줍니다. . 결과적으로, 결합되지 않은 상태에서 이전에 유리한 정전기 상호작용 중 일부가 바람직하지 않게 됩니다. 도미노 효과와 마찬가지로 추가 측쇄 재배열이 발생하여 이 에너지 스트레스를 해제하여 알려진 알로스테릭 부위와 일치하는 특히 N 및 C 말단 영역에서 정전기 및 수소 결합 네트워크를 변경합니다. 이 에너지 재분배가 PDZ3 기능에 어떤 영향을 미칩니까? PDZ 도메인은 일반적으로 단백질 사슬에서 순차적입니다. 한 PDZ 도메인의 에너지 재분배는 동종 네트워크(11)를 통해 두 번째 PDZ 도메인으로 전파되어 세포 신호 전달에 영향을 미칠 수 있습니다. 에너지의 재분배는 유리한 상호 작용과 불리한 상호 작용의 취소로 인해 전체 상호 작용 에너지를 변경하지 않기 때문에 실험에서 이러한 극적인 에너지 재분배를 감지하는 것은 어렵습니다.

Kumawat와 Chakrabarty(3)는 PDZ3 도메인 단백질에 숨겨진 정전기적 기반을 보여줌으로써 정전기 상호작용 재분배가 구조적 변화가 적은 "역학적" 알로스테릭 단백질 사이에서 공통적인 특징인지 또는 이것이 PDZ3 도메인 단백질. PDZ3는 소수성 포켓을 통해 펩타이드를 인식하지만 양전하를 띤 잔기인 K5는 H-결합 네트워크의 재배열을 시작하여 정전기 상호작용 에너지의 변화를 유발합니다(3). 발생하는 한 가지 질문은 결합 계면에서 하전된 잔류물이 정전기 상호작용 에너지 재분배에 중요한지 여부입니다. 예를 들어, cAMP-catabolite activator protein(CAP)은 고전적인 역학 구동 알로스테릭 단백질로 간주되어 왔습니다. 한 cAMP가 CAP에 결합하면 알로스테릭하게 두 번째 cAMP에 대한 결합 친화도가 감소하지만, NMR에서 구조적 변화가 없음을 시사했음에도 불구하고 후속 cAMP-CAP 결정 구조(12, 13)는 DNA 결합 기능에 큰 구조적 변화가 필요함을 나타냅니다. 14). 흥미롭게도, cAMP와의 접촉을 줄이기 위한 CAP의 돌연변이는 이 음성 알로스테릭 협동성을 향상시킬 수 있습니다(15). 하전된 잔류물은 CAP와 cAMP 사이의 상호 작용 인터페이스에 관여합니다. 그런 다음 결합에 의해 교란된 이러한 하전된 잔기가 내부 정전기 상호작용 에너지의 재분배를 유발하여 CAP 알로스테릭 기능에서 역할을 한다고 추측할 수 있습니다. 단백질 키나아제는 또한 동역학적 소수성 코어(17)에 의해 알로스테리가 조정되는 동역학 구동 알로스테릭 단백질(16)로 제안되었습니다. 나비 효과와 마찬가지로 암의 단일 돌연변이는 전체 세포를 리모델링할 수 있습니다(18). 흥미롭게도, BRAF V600E 암 돌연변이와 같은 빈번한 암 돌연변이의 대부분은 하전된 잔기를 포함합니다. 이것은 이러한 전하를 띤 잔기 돌연변이가 측쇄의 동종 네트워크(11) 이동을 통해 단백질 내부와 단백질 사이에서 내부 에너지의 재분배를 유발하는지 여부에 대한 질문을 제기하며, 이는 부분적으로 암의 나비 효과를 설명할 수 있습니다.

정전기적 상호작용은 에너지 재분배의 유일한 소스가 아닙니다. Kumawat와 Chakrabarty(3)는 Van de Waals 상호작용과 H-결합 네트워크가 둘 다 에너지 재분배에 어느 정도 관련되어 있다고 보고합니다. 단백질의 에너지는 잔기 내부와 잔기 사이의 모든 잠재적인 국소 및 장거리 상호작용을 나타냅니다. 한 단백질에서 여러 아미노산 상호작용 네트워크를 확인하여 서로 다른 상호작용을 설명할 수 있습니다(19). 교란 시 하나 이상의 아미노산 상호 작용 네트워크가 다른 정도로 변경될 수 있으며 에너지가 재분배될 수 있습니다. 단백질은 고립된 시스템이 아니라 물 분자를 포함한 환경과 상호 작용합니다. Kumawat와 Chakrabarty(3)는 특정 잔류물에 대한 상당한 국소 용매화 환경 변화를 발견했으며, 이는 에너지 재분배가 단백질 내 또는 단백질 사이에서만 일어나는 것이 아니라 단백질-물 상호작용도 에너지 재분배에 기여함을 나타냅니다.

동적 알로스터리에서 정전기 기반과 동적 기반을 어떻게 통합할 수 있습니까? 이전 연구에서는 동적 알로스터리의 원동력으로 엔트로피를 발전시켰습니다. 최근 몇 가지 계산 및 실험 보고서에 따르면 La Châtelier의 원리가 동적 알로스테리 뒤에 있을 수 있다고 제안했습니다. 강성 잔류물 스캔 분자 역학 시뮬레이션 기반 방법을 사용하여 Kalescky et al. (20, 21)은 PDZ 도메인 단백질의 개별 잔기 강성을 증가시켜 국소 엔트로피를 감소시키면 종종 전체 배열 엔트로피가 증가한다고 보고했습니다. 최근 Law et al.(22) PDZ3 도메인 단백질의 부피가 La Châtelier의 원리에 따라 국소 내부 운동과 결합된다는 것을 밝혔습니다. 흥미롭게도, 말단 부위에서 α3 나선의 결실은 결합 친화도를 감소시키지만 단백질 부피와 엔트로피를 증가시킨다. 에너지 재분배의 관점에서, 국부 엔트로피의 손실은 국부 엔트로피 손실의 균형을 맞추기 위해 전역 엔트로피의 재분배를 촉발합니다. 따라서 동적 알로스테리는 엔트로피의 재분배로도 볼 수 있습니다. 그러나 아미노산 네트워크(정전기, H-결합 네트워크 등)의 집단 이동을 갖도록 측쇄의 배열은 측쇄 역학의 결과입니다. 따라서 우리는 에너지 재분배를 통해 동적 및 형태적 알로스테리의 엔탈피와 엔트로피 기반을 통합할 수 있으며 외부 에너지의 섭동에 따른 내부 에너지 재분배를 통해 알로스테릭 기능이 수행될 수 있음을 제안합니다. 따라서 Kumawat 및 Chakrabarty(3) 관찰은 현재 관점을 다시 초점을 맞추는 데 중요합니다. 알로스테리를 엔트로피 또는 동적으로 분류하기보다는 PDZ3 도메인 단백질의 경우 특정 정전기 상호작용의 내부 재분배 및 개체군 이동의 관점에서 보아야 한다고 주장합니다. 향후 연구에서는 이러한 발견의 일반성과 세포 신호 전달 및 약물 발견에서의 예측을 탐구해야 합니다.


파트 2: GTPase 반응 및 질병

00:00:00.14 안녕하세요. 제 이름은 프레드 위팅호퍼입니다.
00:00:02.18 저는 독일 도르트문트에 있는 막스 플랑크 분자 생리학 연구소의 명예 그룹 리더입니다.
00:00:11.08 그리고 이것은 두 번째 세미나입니다.
00:00:14.01 첫 번째 시간에는 GTP 결합 단백질 또는 G 단백질이라는 분자 스위치에 대해 소개했습니다.
00:00:21.15 그리고 이 두 번째 부분에서는 우리 연구의 특정 측면에 더 집중할 것입니다.
00:00:28.20 GTPase 반응의 메커니즘과 다양한 질병으로 이어지는 방법을 다룹니다.
00:00:34.09 그리고 저는 분명히 첫 번째 세미나에서 이야기한 Ras 유사 단백질에 주로 초점을 맞출 것입니다.
00:00:42.23 그래서, 다시, 간단히, 이 단백질들의 기계적인 순환은:
00:00:49.25 이 단백질은 GDP에 결합된 상태와 GTP에 결합된 상태의 두 가지 맛이 있습니다.
00:00:55.13 그들은 뉴클레오티드가 매우 단단히 결합되어 있습니다.
00:00:58.03 GTP에 대한 GDP를 공개하려면 구아닌 뉴클레오티드 교환 인자가 필요합니다
00:01:03.23 셀에는 GDP보다 GTP가 더 많기 때문입니다.
00:01:06.11 이것이 GDP가 꺼지면 단백질에 GTP가 로드되는 이유입니다.
00:01:10.06 일부 파트너 단백질과 상호 작용하는 GTP 결합 형태에 다운스트림 영향이 있습니다.
00:01:15.10 그리고 스위치를 다시 끄려면 GTPase 반응이 있어야 합니다.
00:01:20.27 단백질은 GTP를 GDP와 Pi로 나눕니다.
00:01:24.29 그리고 이 반응은 매우 느리고 GTPase 활성화 단백질이라는 단백질에 의해 촉매됩니다.
00:01:31.06 이것은 분명히 우리가 이야기할 주요 내용이 될 것입니다.
00:01:36.24 그래서 우리가 말하는 것은 정말 기본적인 생화학 반응입니다
00:01:43.23 즉, phosphoanhydrides의 가수분해와 phosphoesters의 가수분해와 유사합니다.
00:01:53.08 예를 들어, 트레오닌, 세린 또는 티로신에서 인산화된 단백질이 인산화된 경우,
00:01:57.24 물에 의한 인산염에 대한 유사한 친핵성 공격이 있습니다.
00:02:05.04 그리고 분명히 사람들은 이 반응에 대해 많이 이야기해 왔습니다.
00:02:12.15 인산염이 높은 음전하를 띠기 때문에 느린 반응
00:02:19.16 친핵체의 접근, 예를 들어 부분적으로 음전하를 띠는 물,
00:02:25.06 매우, 매우 불리합니다. 이것이 바로 이 반응이 일반적으로 매우 느린 이유입니다.
00:02:30.25 반응이 에너지를 전달하더라도
00:02:33.17 매우 높은 활성화 에너지를 극복해야 하기 때문에 매우 느립니다.
00:02:38.16 제가 방금 말한 음전하에 따라 다릅니다.
00:02:42.04 활성화 에너지가 높을수록 생물 물리학 과정에서 알 수 있습니다.
00:02:46.13 활성화 에너지가 높을수록 반응이 느려지고,
00:02:51.00 반응 속도는 활성화 에너지에 정비례하기 때문입니다.
00:02:54.18 그래서 자연은 전이 상태 에너지를 낮추기 위해 효소를 사용합니다
00:03:00.27 따라서 반응을 더 빠르게 만듭니다.
00:03:03.15 그리고 항상 학생들의 관심을 끄는 흥미로운 기사가 ​​있습니다.
00:03:07.21 몇 년 전에 기사를 작성한 Francis Westheimer의:
00:03:12.01 자연이 인산염을 선택하는 이유.
00:03:13.25 화학자들은 인산염을 이탈기로 사용하지 않기 때문에
00:03:17.13 그러나 생물학에서는 매우 빈번한 이탈 그룹입니다.
00:03:21.16 바로 이 목적 때문에, 제가 여기서 보여준 바로 그 이유 때문에
00:03:26.17 phosphoanhydride 결합 또는 phosphoester 결합은 동역학적으로 안정합니다
00:03:32.06 다시 말해서 ATP 또는 GTP를 물에 담을 수 있으며 영원히 유지되거나 매우 느리게 가수분해됩니다.
00:03:39.22 하지만 열역학적으로는 주로 불안정합니다.
00:03:43.00 효소를 사용하면 활성화 에너지가 낮아집니다. 이 반응을 매우 빠르게 만들 수 있습니다.
00:03:47.14 여러분이 읽어보라고 권하고 싶은 흥미로운 기사입니다.
00:03:50.27 예를 들어, 이것이 DNA가 안정적인 이유이고 ATP가 훌륭한 에너지원인 이유입니다
00:03:57.12 원칙적으로 에너지를 전달하지만 수용액에서는 안정적이기 때문입니다.
00:04:03.28 그럼 먼저 Ras와 GAP 매개 GTPase 반응부터 시작하겠습니다.
00:04:10.25 그것은 실제로 이후에 개발된 많은 것들에 대한 패러다임입니다.
00:04:15.24 이것은 분자 Ras입니다. 구조의 리본 표현
Ras의 G 도메인의 00:04:21.29.
00:04:24.16 당신은 그것의 심장 모양을 볼 수 있습니다.
00:04:27.17 분명히 우리는 그것을 매우 좋아하고 Hiedelberg에서 구조를 해결했습니다.
00:04:32.00 Hiedelberg의 도시 광고, Hiedelberg verloren의 Ich hab mein Herz
00:04:36.04 즉, 나는 Hiedelberg에서 마음을 잃었습니다.
00:04:37.27 하지만 하트 모양의 가장 중요한 이유는
00:04:41.13 사람들은 이것을 신호 변환의 심장이라고 부릅니다.
00:04:44.06 그리고 조절하는 가장 중요한 분자 중 하나는
00:04:48.14 성장, 분화, 때로는 세포자살과 같은 중요한 신호 전달 과정.
00:04:54.17 그리고 당신은 아마도 신호 변환 과정에 대해 조금 알고 있을 것입니다. 왜냐하면
00:04:59.07 모든 교과서에는 신호 변환 사슬의 패러다임 중 하나인 이 버전이 있습니다.
00:05:04.01 예를 들어, 성장 인자는 세포막에 결합합니다.
00:05:08.27 성장 인자 수용체 RTK(수용체 티로신 키나제)에 결합
00:05:14.22 이에 의해 인산화됩니다. 교환인자 SoS를 모집합니다.
00:05:19.04 그러면 Ras가 GDP 바운드 형태로 활성화됩니다.
00:05:22.16 이제 Ras는 Raf 키나제인 다운스트림 구성 요소와 상호 작용합니다.
00:05:26.15 이것은 MAP 키나제 모듈이라고 불리는 것에 대한 시작 키나제입니다.
00:05:30.24 거기에서 하나의 키나제가 MAP 키나제 키나제라고 하는 다음 다운스트림 키나제를 활성화합니다.
00:05:36.29 MAP 키나아제 키나아제는 MAP 키나아제 키나아제를 활성화하고 MAP 키나아제를 활성화합니다
00:05:40.28 그런 다음 핵으로 들어가서 전사를 활성화합니다.
00:05:45.03 이것은 Ras가 실제로 하는 일을 매우 단순화한 버전입니다.
00:05:48.16 그리고 이것은 처음으로 발견된 것입니다(첫 번째 신호 변환).
00:05:54.15 하지만 이제는 점점 더 복잡해집니다.
00:05:57.26 이것은 여전히 ​​매우 단순화 된 버전이지만 이미 보여줍니다.
00:06:00.27 많은 업스트림 구성 요소가 와서 Ras를 활성화한다는 점에서 Ras를 통한 신호 변환의 주요 사항입니다.
00:06:09.18 티로신 키나제 수용체 또는 G-단백질 결합 수용체 중 하나입니다
00:06:13.09 또는 T 세포 수용체. 그들 모두는 라스를 활성화할 수 있습니다.
00:06:16.08 그런 다음 Ras는 다운스트림에서 Raf 키나아제뿐만 아니라 많은 구성 요소를 활성화할 수 있습니다.
00:06:20.18 Ral GEF, PI(3) 키나제, PLC 엡실론 등의 분자도 있습니다.
00:06:26.22 그리고 그들은 많은 신호 전달 반응을 중재합니다
00:06:32.12 어딘가에 통합되어 있다고 가정해 봅시다.
00:06:38.00 전사인자에 의해 개시, 역치가 맞을 때, 반응수가 맞을 때,
00:06:46.15 그것은 증식이나 분화 또는 무엇이든 될 수 있는 세포 반응을 시작합니다.
00:06:52.03 그리고 나는 스위치-오프 반응에 집중하고 싶기 때문에 이것의 어떤 측면도 다루지 않을 것입니다.
00:06:57.28 그래서 스위치 끄기 반응은 다시 당신이 본 계획입니다, 지금, 여러 번
00:07:03.25 하지만 Ras에서 일어나는 일은 종양 유전자이기도 합니다.
00:07:06.26 글리신 12가 다른 아미노산으로 돌연변이된 두 가지 유형의 돌연변이가 있는 종양 유전자
00:07:13.10 또는 다른 아미노산으로 돌연변이된 글루타민 61.
00:07:16.21 그리고 이것이 생화학적으로 하는 일은 GAP 매개 GTPase 반응을 차단한다는 것입니다.
00:07:23.21 무슨 일이 일어나는지 상상할 수 있습니다. 비활성 상태로의 복귀를 차단했습니다
00:07:29.13 그래서 이제 Ras를 GTP 바인딩 형식으로 축적합니다.
00:07:33.09 Ras가 이미 GTP 바인딩 상태에 있기 때문에 더 이상 업스트림 신호가 필요하지 않습니다.
00:07:39.03 그리고 이제 더 이상 규제되지 않는 효과가 있으며 이것이 암으로 이어지는 이유입니다.
00:07:44.14 이 간단한 돌연변이입니다. 그것이 바로 구조 생화학자로서 분명히 이유입니다.
00:07:49.23 다음과 같은 질문을 하는 것은 매우 흥미로운 프로젝트입니다.
00:07:52.00 단일 점 돌연변이가 어떻게 그렇게 극적인 결과를 초래할 수 있습니까?
00:07:58.19 그리고 그것 또한. Ras가 가장 빈번한 종양 유전자이기 때문에 분명히.
00:08:02.28 클리닉에 오는 사람들의 약 25%가 종양 진단을 받고,
00:08:09.07 제가 보여드린 것 중 하나인 Ras 돌연변이가 있습니다. 적어도 이것들은 가장 빈번한 것들입니다.
00:08:15.00 분명히 모든 제약 회사는 Ras 경로를 억제하기 위해 노력하고 있습니다
00:08:20.29 및 Ras 매개 암을 치료하는 방법으로 Ras 신호 전달.
00:08:25.28 그리고 생각할 수 있는 많은 접근 방식이 있습니다.
00:08:30.17 여기에 몇 가지만 표시했습니다. 예를 들어 Ras를 생각할 수 있습니다. 파르네실화
00:08:36.25 C-말단 시스테인에 있고 그 반응을 매개하는 파르네실 전이효소라는 효소가 있습니다.
00:08:44.18 임상에서 효능에 대해 테스트 중인 파르네실 전이효소 억제제가 있습니다.
00:08:50.00 하지만 다운스트림 이펙터와의 상호 작용을 억제하는 것도 생각할 수 있습니다.
00:08:54.15 이것은 예를 들어 우리가 결정한 구조입니다: Ras와 Raf 키나아제(또는 Raf 키나아제의 일부) 사이의 복합체.
00:09:00.10 아니면 생각할 수도 있습니다. 그것이 우리가 여전히 노력하고 있는 것입니다.
00:09:04.21 우리의 꿈의 접근 방식입니다. 발암성 Ras의 기본 특징은 GTP를 가수분해할 수 없다는 것입니다.
00:09:12.09 발암성 Ras에서 GTP 가수분해를 유도하는 작은 분자를 만드는 것에 대해 생각해 볼 수 있습니까?
00:09:18.21 이것은 아마도 꿈의 프로젝트이고 우리는 그것을 실현 가능하게 만들기 위해 여전히 노력하고 있습니다.
00:09:25.05 하지만 세미나 프레젠테이션 과정에서 우리가 여전히 가능하다고 생각하는 이유를 보여 드리겠습니다.
00:09:32.23 그것의 화학은 그렇게 어렵지 않아야 한다는 것입니다.
00:09:36.14 그리고 나는 당신을 설득할 수 있기를 바랍니다.
00:09:40.26 그래서, 여기서 우리는 GTP의 감마 인산염에 대한 물의 친핵성 공격에 대해 이야기하고 있습니다.
00:09:49.03 RasGAP에 의해 매개되며 Ras-GDP와 Pi를 생성합니다. 간단한 생화학 반응
00:09:56.09 하지만 작동하지 않으면 암이라는 매우 과감한 결과로 이어집니다.
00:10:00.21 우선 (그리고 당신은 그 그림도 여러 번 본 적이 있습니다.
00:10:05.24 이것은 항상 내 소개 슬라이드입니다)
00:10:08.09는 가장 자주 돌연변이되는 두 개의 아미노산입니다.
00:10:13.16 (둘 중 하나) Ras의 발암성 버전에서 활성 부위에 매우 가깝습니다.
00:10:18.07 여기 뉴클레오타이드가 보입니다. 이것이 감마 포스페이트입니다.
00:10:22.07 그리고 이것은 글루타민 61이고 글리신 12는 활성 부위에 매우 가깝습니다.
00:10:28.10 분명히 이전에 예상했거나 생각했던 것처럼
00:10:32.06 그들은 GTPase 반응에 어떻게든 관련되어 있다는 것입니다.
00:10:35.22 이제, 우리는 그들이 실제로 하는 일과 돌연변이가 GTP 가수분해를 차단하는 이유를 분명히 보여줄 것입니다.
00:10:43.08 그리고 여기 Ras 활성 사이트의 표면 표현에서도 볼 수 있습니다.
00:10:49.12 이 GTP라면. 그래서 앉는다. 그것의 표면에 바인딩
00:10:53.26 그리고 감마 포스페이트가 외부에서 여전히 접근할 수 있다는 것을 알 수 있습니다.
00:10:57.03 그리고 그것은 내가 이야기할 맥락에서 중요할 것입니다
00:11:01.12 그리고 지난 시간에 마그네슘의 중요성에 대해 말씀드린 적이 있습니다.
00:11:05.20 주변에 마그네슘이 없으면 GTP 가수분해 반응도 일어나지 않습니다.
00:11:09.24 포유류 게놈에는 항상 그렇듯이 RasGAP가 하나만 있는 것이 아니라 12 또는 13이 있습니다.
00:11:19.08 그리고 여기에 몇 가지를 표시했습니다.
00:11:24.06 그리고 여러분은 그것들이 모두 약 330개의 잔기로 이루어진 하나의 특정 도메인을 포함한다는 것을 알 수 있습니다.
00:11:28.09 이것은 그 자체로 빠른 GTP 가수분해 반응을 시작할 수 있는 RasGAP 도메인입니다.
00:11:36.17 그리고 이 모든 단백질이 서로 다른 도메인으로 구성되어 있음을 알 수 있습니다.
00:11:43.03 그리고 일부는 비슷하고 일부는 크게 다릅니다.
00:11:45.20 그리고 그들은 분명히 세포의 다른 맥락에서 Ras를 조절하고 있습니다
00:11:50.04 다른 도메인이 있기 때문입니다.
00:11:53.15 그리고 Frank McCormick이 발견한 최초의 RasGAP인 P120GAP에 대해 이야기하겠습니다.
00:12:02.06 그리고 나중에 NF1에 대해 이야기하겠습니다.
00:12:05.05 이는 종양 억제 유전자이기 때문에 종양 형성에 중요한 또 다른 요소입니다.
00:12:12.04 우선, 다시 한 번 상기시켜드리자면, 고유 GTP 가수분해는 매우 느립니다.
00:12:17.23 그러나 GTPase 활성화 단백질을 추가하면 빠릅니다.
00:12:21.08 그래서 여기서 제가 하고 있는 것은 방사성 GTP(예: 감마 라벨)를 복용하는 것입니다.
00:12:25.27 그런 다음 시간 경과에 따른 Pi 생산량을 측정합니다.
00:12:29.26 보시다시피, 이 반응(실온에서)은 거의 무시할 수 있습니다.
00:12:35.14 GAP가 없는 실온에서 일반 Ras의 가수분해는 거의 없습니다.
00:12:40.12 그리고 이제 특정 양의 RasGAP를 추가하면 매우 빠른 반응이 있음을 알 수 있습니다.
00:12:44.23 훨씬 빠릅니다.
00:12:46.04 그리고 제한된 조건에서 실제로는 그 반응의 약 10^5배 자극입니다.
00:12:53.10 이것이 우리가 보고 싶은 방식입니다.
00:12:57.05 우리는 GAP가 이 빠른 GTP 가수분해 반응을 어떻게 매개하는지 분석하고자 합니다.
00:13:03.14 따라서 처음에는 분명히 스스로에게 묻습니다. 가수분해의 메커니즘은 무엇일 수 있습니까?
00:13:10.11 그리고 GAP에 의해 촉진되는 단계는 무엇입니까?
00:13:14.02 Ras-GTP는 원칙적으로 빠른 GTP 가수분해 효소라고 생각할 수 있습니다.
00:13:20.14 그러나 이성질체화 반응에 의해 GTPase 적격 상태가 되어야 합니다.
00:13:26.15 그리고 그것은 매우 느리고 GAP에 의해 촉진됩니다.
00:13:28.29 또는 GTP에서 GDP Pi로 가는 실제 분열 반응이
00:13:35.02 매우 느리고 GAP에 의해 촉진됩니다.
00:13:38.01 또는 그 모든 것이 여전히 매우 빠르다고 생각할 수도 있습니다.
00:13:41.09 그러나 Pi의 제품 출시는 매우 느리고 GAP에 의해 촉진됩니다.
00:13:47.08 예를 들어, ATP가 미오신에서 가수분해되는 것에 대해 들었던 것을 기억한다면,
00:13:53.26 미오신은 예를 들어 매우 빠른 GTPase이지만 Pi 방출은 매우 느립니다.
00:13:59.00 및 액틴에 의해 촉진되어야 합니다.
00:14:01.04 즉, 이 특정 경우에 GAP에 의해 촉매되는 실제 단계는 무엇입니까?
00:14:07.10 그리고 나는 그것이 분열 반응 그 자체라고 말해야합니다.
00:14:11.12 GTPase 활성화 단백질의 주요 공격 포인트
00:14:16.21 그리고 GAP가 있을 때만 다른 반응을 하는
00:14:20.18 적어도 부분적으로 속도 제한이 되며 적어도 Pi 릴리스가 됩니다.
00:14:24.10 그리고 나중에도 보여드리겠습니다.
00:14:27.29 전에도 보여드렸지만 다시 반복하겠습니다.
00:14:32.12 형광 뉴클레오티드로 생화학을 수행하는 연구에서 많이 사용하는 것은
00:14:38.20 mant 또는 mGDP 또는 mGTP 아날로그를 사용합니다.
00:14:42.29 리보오스에 형광 리포터 그룹이 있습니다.
00:14:46.24 그래서 이것은 데옥시 리보스 또는 리보스가 될 것이고 리보스에 당신이 묶인
00:14:52.17 이 에스테르 결합은 그것이 앉아 있는 환경에 매우 민감한 맨트 그룹입니다.
00:14:59.19 이것이 바로 제가 잠시 후에 보여드릴 것처럼 항상 매우 아름다운 구조적 변화를 주는 이유입니다.
00:15:07.10 우리는 GTPase 반응을 기억하기 때문에 빠른 반응을 측정하기 위해 정지 흐름을 사용했습니다.
00:15:13.29 GAP가 없으면 느린 것이 매우 빨라집니다.
00:15:17.15 그래서 그것을 자세히 분석하려면 정지-유동 역학을 사용해야 합니다.
00:15:21.16 예를 들어 다음 작업을 수행할 수 있습니다. Ras 레이블이
00:15:25.10 mant-GTP(그래서 GTP의 형광 버전입니다)
00:15:28.16 GAP가 있고 형광 감지 큐벳에 함께 쐈어.
00:15:34.02 그리고 여기 위로 흐름을 중지해야 합니다.
00:15:37.17 이 두 주사기의 일정량의 액체만 반응 챔버에 넣어야 합니다.
00:15:44.07 그렇게 하면 이 두 가지를 함께 촬영할 때
00:15:50.09 Ras-mantGTP를 사용하면 형광성이 증가하고 감소합니다.
00:15:54.09 다시 증가 속도가 매우 빠릅니다.
00:15:56.25 그것은 두 단백질이 복합체를 만든다는 것을 의미합니다.
00:15:58.27 그리고 시간이 지남에 따라 복합체가 해리됩니다. 가수분해 후 뉴로피브로민이 더 이상 Ras에 결합하지 않기 때문입니다.
00:16:07.18 보시다시피 1초 후에 이 모든 것이 끝났습니다.
00:16:10.09 포화된 양의 GAP가 존재할 때 매우 빠른 인-전달 반응입니다.
00:16:15.07 그리고 컨트롤로 우리는 아날로그 GppNHp에 바인딩된 Ras를 사용합니다.
00:16:21.25 베타와 감마 인산염 사이에 NH 기가 있다는
00:16:25.16 더 이상 가수분해할 수 없으며 이제 매우 빠르게 증가합니다.
00:16:30.17(복합체 형성) 그러나 가수분해될 수 없기 때문에 해리가 없습니다.
00:16:35.05 이것은 해리가 GTP 가수분해로 인한 것이라는 증거이기도 합니다.
00:16:40.21 그래서 누군가는 "여기 이 반응에서 GAP에 어떤 잔류물이 있는지,
00:16:50.01 이 빠른 GTP 가수분해 반응을 매개하는 데 관여합니다. 그 반응의 10^5배 자극?"
00:16:58.17 그리고 분명히, 당신은 어떤 잔기, 어떤 아미노산이 그 일을 할 수 있는지 생각하고 있었습니다.
00:17:03.16 아니면 하나 이상의 아미노산입니까?
00:17:05.16 그리고 좋은 후보로서 우리는 아르기닌
00:17:08.16 다른 G-단백질을 보면 G-알파 단백질(이종삼량체 G 단백질의)
00:17:15.02 두 개의 도메인으로 구성된 것으로 알려져 있습니다.
00:17:18.25 이 파란색 영역은 G 영역이고 빨간색 부분은 나선형 추가 영역입니다.
00:17:24.21 하지만 그 나선 영역에는 활성 부위에 바로 자리 잡고 있는 아르기닌이 있습니다.
00:17:29.24 아르기닌이 반응에 중요한 것으로 나타났습니다.
00:17:33.29 아주 오래된 실험에서
00:17:37.20 콜레라를 유발하는 비브리오 콜레라라는 세균성 병원체가 있기 때문에
00:17:45.29 그리고 실제로 하는 일은 이 G-알파 단백질에서 이 아르기닌을 수정한다는 것입니다.
00:17:51.16 알다시피, NAD가 있고 콜레라 독소가 ADP-리보스를 옮깁니다.
00:17:58.03 여기에 표시된 G-알파의 아르기닌. 이것은 실제로 여기 교과서에서 가져온 것입니다.
00:18:02.26 이것은 아주 오래된 반응입니다. 그것은 여러 해 전에 분석되었습니다.
00:18:07.10 이 반응을 할 때 차단할 때
00:18:10.16 G-알파 단백질에 대한 GTPase 반응, 더 이상 GTP 가수분해가 없습니다
00:18:16.10 그리고 단백질은 이제 순환 AMP를 생산하고 있습니다.
00:18:19.14 채널(cyclicAMP-gated ion channel)을 열면 콜레라의 이러한 모든 증상이 나타납니다.
00:18:26.19 다시 질문: 아르기닌이 좋은 후보가 될까요?
00:18:29.29 그래서 제가 보여드린 모든 RasGAP에서 보존된 아르기닌을 찾았습니다.
00:18:33.24 그리고 실제로 우리는 몇 개를 찾았습니다. 대부분은 아무런 차이가 없었습니다.
00:18:38.06 그러나 돌연변이되었을 때 반응에서 다음 패턴을 나타내는 아르기닌은 단 하나뿐이었습니다.
00:18:43.19 그래서 당신은 다시 녹색 버전을 가지고 있습니다 (이것은 야생형 버전입니다)
00:18:47.23 복합체 형성으로 인한 빠른 증가, GTP 가수분해 후 해리로 인한 빠른 감소.
00:18:53.16 그리고 여기 이 돌연변이들과 함께, 아르기닌은 라이신이나 알라닌으로 돌연변이되었습니다
00:18:58.11 또는 변경하려는 모든 항목,
00:19:00.03 반응이 다시 증가하지만 가수분해는 전혀 발생하지 않고 그대로 유지됩니다.
00:19:06.13 또는 적어도 이러한 상황에서 최대 1초까지는 가수분해가 없습니다.
00:19:10.16 이것은 분명히 이 아르기닌이 반응에 필수적이어야 함을 이미 알려줍니다.
00:19:18.02 지금까지는 너무 좋습니다. 생화학은 분명했다
00:19:21.09 하지만 분명히 당신은 문맥에서 아르기닌이 무엇을 하는지 알지 못합니다.
00:19:24.05 당신은 그것이 활성 사이트에 들어갈 수 있다는 아이디어가 있다고 생각합니다
00:19:28.02 하지만 다시 말하지만 구조가 실제로 무엇을 하는지 알려줄 때까지 기다려야 합니다.
00:19:33.21 우선 phospho-transfer 반응을 분석하기 위한 또 다른 중요한 개념을 소개하겠습니다.
00:19:40.12 그리고 그것은 알루미늄 플루오라이드 착물을 사용하는 것입니다.
00:19:43.02 그러한 무기 분자가 왜 중요한지 궁금할 것입니다.
00:19:47.14 하지만 전환 상태의 특성을 보면
00:19:51.20 그래서 이것은 GTP가 물의 공격을 받는 것입니다.
00:19:55.18 인산염이 이제 삼각형의 평평한 것을 만드는 전환 상태가 있습니다.
00:20:00.26 여기서 친핵성 산소와 이탈기 산소는 반대편에 있습니다.
00:20:08.22는 이 5배위 포스페이트의 축 리간드입니다.
00:20:12.11 이 전환 상태는 매우 빡빡할 수 있습니다(이를 연관이라고 함).
00:20:18.16 또는 인산염과 두 축 리간드 사이의 거리에 따라 매우 느슨합니다.
00:20:25.26 그리고 다시 사방정계 인산염(이 Pi가 없는 인산염)으로 끝납니다.
00:20:32.08 불화알루미늄이
00:20:36.05 (알루미늄과 불소 사이의 거리가 매우 유사합니다.
00:20:39.23 인산염과 산소 사이의 전자음도 매우 높음)
00:20:44.26 이것은 phospho-transfer 반응의 전이 상태를 아주 잘 모방한 것입니다.
00:20:51.02 유일한 문제는 예를 들어 키네신이나 미오신 또는
00:20:56.28 다른 많은 인산 전달 효소는 불화알루미늄을
00:21:02.07 전이 상태의 감마-인산염,
00:21:04.17 Ras 또는 Rho 및 이러한 모든 Ras 유사 단백질은 결코 그것을 보여주지 않았습니다.
00:21:08.25 여기 그 실험이 보입니다.
00:21:11.19 Ras-mantGDP를 사용합니다(약 440에서 최대값을 갖는 특정 형광 방출 스펙트럼을 가짐)
00:21:19.03 이제 GAP를 추가하면 스펙트럼에 아무런 변화가 없습니다.
00:21:24.12 아무 일도 일어나지 않습니다.
00:21:25.11 하지만 이제 알루미늄 플루오라이드를 추가하면 무엇보다 먼저 파란색 이동이 발생한다는 것을 알 수 있습니다.
00:21:31.00 그리고 흡수가 증가합니다.
00:21:37.11 Ras, NF1 및 불화알루미늄 사이에 삼량체 복합체가 있음을 의미합니다
00:21:42.07 불화알루미늄이 감마 인산염 결합 부위에 있는 곳입니다.
00:21:47.10 그리고 그것은 매우 중요했습니다.
00:21:48.25 그런데 만약 당신이 지금 발암 돌연변이에서 이것을 한다면
00:21:52.02 우리가 알고 있는 GTP를 가수분해하지 않고 동일한 실험을 하고,
00:21:55.15 알다시피, 불화알루미늄과 Ras가 있으면 형광성 변화가 없습니다.
00:22:00.06 이제 NF1을 추가하면 형광이 증가하지 않습니다.
00:22:04.12 가수분해되지 않는 돌연변이(Q61L)가 있기 때문입니다.
00:22:08.13 예를 들어 아르기닌 돌연변이와 같은 NF1 돌연변이를 취할 수도 있습니다.
00:22:13.22 그리고 다시 어떤 변화도 없을 것입니다.
00:22:16.05 다시 말해서, 이 실험이 우리에게 다시 말해 주는 것은 불완전한 인산 전달 효소에 있는 Ras입니다.
00:22:22.22 인산 전달 효소처럼 보이려면 GAP의 존재가 필요합니다
00:22:28.05 Ras 또는 NF1에서 GTPase 반응을 차단하는 돌연변이가 있는 경우
00:22:33.22 우리는 또한 알루미늄 플루오라이드 착물을 얻지 못합니다.
00:22:37.09 분명히 이 모든 것이 생화학 측면에서 훌륭합니다.
00:22:42.00 하지만 GTPase 반응을 실제로 중재하는 것은 빠른 것입니다.
00:22:47.22 Ras 및 RasGAP 콤플렉스의 구조를 살펴봐야만 확인할 수 있다고 생각합니다.
00:22:55.29 이것은 여기에 표시됩니다. 그래서 이것이 이런 반응을 분석하기 위한 패러다임이었습니다.
00:23:02.06 예를 들어 빨간색으로 Ras가 표시되고 녹색 아래가 RasGAP 도메인(P120 GAP)입니다.
00:23:09.13 그리고 당신이 보는 것은 여기입니다. 아주 유심히 보면
00:23:12.04 활성 사이트로 들어가는 GAP의 잔류물이 있음을 알 수 있습니다.
00:23:17.14 그것이 돌아올 때 당신은 그것을 볼 수 있습니다. 당신은 바로 거기를 참조하십시오.
00:23:21.01 Ras의 활성 부위를 가리키는 아르기닌 잔기가 있습니다
00:23:26.04 및 다음 슬라이드에서 수행하는 작업을 보여 줍니다.
00:23:29.06 우선, 이 슬라이드에서 알루미늄 플루오라이드가 실제로 평평한 삼각형임을 보여줍니다.
00:23:34.00 이탈기와 친핵성 물 사이에 위치합니다.
00:23:38.07 따라서 전환 상태의 모방이 있습니다.
00:23:39.28 그러면 빠른 GTP 가수분해를 매개하는 잔류물이 무엇인지 알 수 있습니다.
00:23:45.17 이것은 인산염,
00:23:48.14 그래서 지금 우리는 불화알루미늄을 제거하고
00:23:52.06 실제 전환 상태가 어떻게 생겼는지 생각해 보세요
00:23:55.06 친핵성 물이 있고 전이 상태가 있습니다.
00:23:58.29 감마 인산염에 결합된 곳
00:24:00.25 그리고 글루타민은 인산염에 대해 물을 고정하고 있습니다.
00:24:05.07 수용체와 수소 결합 공여체 상호 작용에 의해.
00:24:09.17 그리고 아르기닌(우리가 아르기닌 핑거라고 부르는 것)은 무엇보다도 안정화
00:24:13.29 글루타민의 위치와 또한 이 양전하를 전달합니다
00:24:18.03 아미노 그룹의 감마 포스페이트에서 전하를 중화합니다.
00:24:22.28 이것이 반응에 정말 중요한 두 개의 잔류물입니다.
00:24:27.08 Ras의 글루타민 61과 RasGAP의 아르기닌 핑거.
00:24:32.05 그리고 이것은 예를 들어 발암성 Ras에서 글루타민 61의 돌연변이가 발생하는 이유를 이미 설명합니다.
00:24:37.19 가수분해 반응을 엉망으로 만들었습니다. 예를 들어,
00:24:42.09 류신이나 무엇이든 여기에서 이런 종류의 상호작용을 할 수 없다면.
00:24:47.00 글루타민 61의 돌연변이는 직접적인 촉매 잔기이기 때문에 발암성입니다.
00:24:53.16 따라서 구조는 글리신 12의 돌연변이가 발암성인 이유도 설명합니다.
00:24:58.22 이 슬라이드에서도 쉽게 볼 수 있습니다.
00:25:02.04 당신은 글리신 12를 가지고 있는데 어떤 잔기로 돌연변이가 일어나면 그것을 발암유전자로 만듭니다.
00:25:06.25 그리고 나서 알루미늄 플루오라이드가 평평한 삼각형인 것을 볼 수 있습니다.
00:25:11.08 거기에 글루타민 61이 있고 여기 아래에 아르기닌 손가락이 있습니다.
00:25:16.09 그리고 이 파란색 점선으로 표시된 모두 매우 가까이 있습니다.
00:25:20.04 이는 거의 VanDerWaals 거리임을 나타냅니다.
00:25:24.04 이제 예를 들어 글리신을 가능한 가장 작은 아미노산으로 돌연변이시키면
00:25:28.11 그것은 알라닌이 될 것입니다. 활성 부위에 있는 이 모든 잔류물을 즉시 엉망으로 만들 것입니다.
00:25:34.01 그래서 입체적인 이유로, 다른 잔류물이 있을 수 없습니다
00:25:36.24 글리신을 제외한 전이 상태의 활성 부위.
00:25:43.08 이 모든 것의 메시지는 분명히 아르기닌이 있다는 것이었습니다.
00:25:49.00 GTPase 반응의 방아쇠를 당기는 아르기닌 손가락이라고 합니다.
00:25:54.00 없으면 매우 느리고 있으면 10^5배 빨라집니다.
00:26:01.01 우리도 사용했습니다. 다시 질문으로 돌아가겠습니다. 이제 전체 프로세스에서 속도 제한이 무엇입니까?
00:26:07.00 따라서 고유 GTP 가수분해의 주요 조절 단계는 매우 느린 화학적 단계인 느린 가수분해입니다.
00:26:14.29 하지만 다른 기술을 사용하여 이제
00:26:17.25 부분적으로 속도 제한이 되는 또 다른 단계가 있으며 잠시 후 이를 보여드리겠습니다.
00:26:23.29 그래서 우리는 시간 분해 푸리에 변환 적외선 분광법을 사용합니다.
00:26:28.10 그리고 그것으로 우리는 거의 원자적 분해능을 할 수 있습니다.
00:26:33.11 밀리초 단위로 활성 부위의 원자를 볼 수 있습니다.
00:26:37.27 아미드 I 및 아미드 II 밴드가 있는 단백질의 적외선 스펙트럼을 보면
00:26:47.20 에 대한 정보가 혼합되어 있기 때문에 구조화된 정보가 아닙니다.
00:26:54.26 알파 나선, 베타 시트 등은 그러한 사진에서 많은 세부 사항을 가져올 수 없습니다.
00:27:02.26 하지만 우리가 하는 것은 반응을 관찰하는 것입니다. 단백질이 A에서 B로 간다고 하자
00:27:09.05 우리는 적어도 이 흡수 규모에서 다른 스펙트럼을 관찰합니다.
00:27:16.19 차이가 별로 안 나지만 자세히 보면.
00:27:20.15 여기 흡수율은 0.0이고 아래 흡수율은 0.02입니다.
00:27:25.14 매우 작지만 매우 재현 가능한 변경 사항을 볼 수 있습니다.
00:27:29.21 반응 과정에서 A가 B로 갈 때.
00:27:33.02 그리고 우리는 A가 사라지는 것을 의미하는 음의 봉우리를 보고 B가 나타나면 양의 봉우리를 봅니다.
00:27:40.22 잃어버린 것들과 떠오르는 것들을 관찰할 수 있도록
00:27:43.29 반응이 진행되는 동안 FTIR에서 이를 따를 수 있습니다.
00:27:49.25 그리고 그렇게 한다면. 따라서 우선 특정 시점에서 반응을 촉발해야 합니다.
00:27:56.25 두 번째 시간 척도의 구조적 변화를 관찰하기 위해.
00:28:03.04 그렇게 하기 위해 다시 다른 아날로그를 사용합니다.
00:28:07.00 및 다른 아날로그는 Roger Goody가 개발한 케이지 GTP입니다.
00:28:10.22 연구소에서 제 동료입니다.
00:28:14.05 그리고 이 케이지 GTP는 케이지 그룹이라고 하는 것에 의해 인산 감마에서 차단됩니다.
00:28:20.22 그래서 가수분해를 허용하지 않지만 이제 플래시를 사용하여 케이지 그룹을 분리할 수 있습니다.
00:28:26.21 이제 Ras-GTP가 있어 GDP와 Pi로 가수분해할 수 있습니다.
00:28:31.19 GAP가 없는 Ras로 그렇게 하면
00:28:39.11 당신이 보는 것은 당신이 가지고 있다는 것입니다. 예를 들어 흡광도가 보입니다.
00:28:44.22 적외선에서 알 수 있는 흡광도는 결합에서 원자 진동을 보여줍니다.
00:28:51.09 예를 들어,
00:28:53.15 알파, 베타, 감마는 끝으로 갈수록 줄어들고 2시간 5분 후에 0이 됩니다.
00:29:00.29 차이 스펙트럼(시작 스펙트럼에서 끝 스펙트럼 빼기)
00:29:06.16 그러면 반응 중에 일어나는 변화만 볼 수 있습니다.
00:29:11.23 그리고 그것은 아주 정상입니다. Ras가 GTP를 가수분해할 때 단일 지수 붕괴가 있습니다.
00:29:18.21 별거 아닙니다.
00:29:20.15 하지만 흥미로운 점은 GAP 매개 반응을 분석할 때
00:29:24.26 지금은 기하급수적 붕괴가 하나도 보이지 않지만 갑자기 중간체가 나타나는 것을 볼 수 있기 때문입니다.
00:29:30.14 오르락 내리락 하는 봉우리가 보이고 가장 중요한 것은
00:29:35.04는 이 숫자 1113으로 표시됩니다. 이것은 특정 변경에 대한 빈도입니다.
00:29:39.28 따라서 각 밴드가 무엇을 하는지, 무엇에 속하는지 분석해야 합니다.
00:29:47.06 그래서 우리는 순서대로 하고 있습니다. 우리는 이러한 기술을 개발했습니다
00:29:52.17 또는 우리가 협력하는 보훔 대학교의 동료들
00:29:56.03 그들은 각 대역폭이 무엇인지 알아내는 기술을 개발했으며,
00:30:01.01 각 주파수는 무엇입니까? 흡광도 변화. 무엇 때문인지.
00:30:03.28 예를 들어, GTP의 경우 흡광도 변화가 있음을 알게 됩니다.
00:30:10.13 속도 상수 k2. 따라서 k1은 광이성질화이고, k2는 하나의 반응이고 k3은 다음 반응입니다.
00:30:17.18 그리고 그렇게 하면 k3로 증가와 감소를 얻습니다.
00:30:21.12 그리고 1113에서 오는 중간이 있습니다.
00:30:26.12 k2로 나오고 k3로 감쇄합니다.
00:30:30.01 k3와 함께 제공되는 무료 파이가 있습니다. 이 모든 것에서 우리는 분명히 결론을 내릴 수 있습니다.
00:30:35.18 여기에 이 ​​흡수 주파수를 가진 Pi 중간체가 있다는 것, 1113 cm^-1
00:30:44.02는 속도 상수 k2로 나타나고 속도 상수 k3으로 감소합니다.
00:30:50.03 즉, Pi 릴리스가 이제 가시화되고 있습니다.
00:30:54.25 그래서 우리는 이 Pi 피크가 올라올 때 가수분해를 봅니다.
00:30:58.21 그리고 그것이 사라질 때 우리는 부패를 봅니다.
00:31:01.01 예를 들어 실시간으로 여기에서 볼 수 있습니다.
00:31:03.25 따라서 흡수는 속도 상수 k2에 따라 변합니다. 여기에서 계획을 볼 수 있습니다.
00:31:09.05 Ras가 켜진 상태에서 Pi 상태로 바뀌고 단백질 결합 Pi가 있는 것을 볼 때
00:31:17.13 그게 올라오고 Pi 밴드는 반응의 과정에서 내려갑니다.
00:31:21.20 그리고 이것은 여러 번 반복됩니다.
00:31:23.07 그리고 반응실을 드나드는 아르기닌 핑거도 있습니다.
00:31:30.00 단백질 밴드 뿐만 아니라
00:31:32.16 우리는 밀리초 단위의 원자 분해능에서 인산염 밴드를 추적할 수 있습니다.
00:31:40.26 그리고 그것은 지금 우리에게 모두 함께 말해줍니다. 이것이 이 모든 것의 메시지입니다.
00:31:46.01 92kJ/mol의 고유 가수분해 반응에 대한 높은 활성화 에너지를 가지고 있는 동안
00:31:54.01 이제 반응을 두 개의 부분 반응으로 분리합니다.
00:31:57.16 활성화 에너지가 더 낮기 때문에 훨씬 빨라집니다.
00:32:01.08 그래서 당신은 분열 반응을 위한 첫 번째 활성화 에너지를 가지고 있습니다. Ras-GDP-Pi로 이어집니다.
00:32:08.03 그리고 두 번째 단계로 Pi 릴리스가 있고 이제 제품이 있습니다.
00:32:12.14 다시 말하지만, 효소학의 일반적인 주제입니다.
00:32:15.12 효소 촉매 반응이 활성화 에너지를 낮추는
00:32:20.00 하나의 반응을 낮추는 것뿐만 아니라 부분적인 단계로 세분화하여
00:32:24.28 각각은 다른 활성화 에너지를 가지고 있습니다.
00:32:29.22 그리고 여기에서 이 활성화 에너지가 59kcal/mol이고 66이라는 것을 알 수 있습니다.
00:32:36.04 이것은 약간 더 높으며 이것이 전체 반응의 부분적으로 속도 제한 단계인 이유입니다.
00:32:45.12 그럼 이제 줄게. 그것이 Ras이고 그것이 종양 형성으로 이어지는 방법
00:32:50.14 그리고 우리는 이것이 생물물리학적 수준에서도 어떻게 기능하는지 자세히 분석했습니다.
00:32:55.02 하지만 이제 왜 특정 GTPase 반응이 작동하지 않을 때,
00:33:03.00 다양한 유형의 질병을 유발하는 방법.
00:33:05.20 신경섬유종증이 그 중 하나입니다.
00:33:07.27 나는 이미 뉴로피브로민, 유전자의 유전자 산물이 Ras GAP임을 보여주었습니다.
00:33:15.09 그리고 I형 신경섬유종증이라는 질병이 있습니다. 사람들이 피부에 까페오레 반점을 가지고 있는 것은
00:33:22.21 때로는 피부에 작은 종양이 있으며 때로는 다소 크고 매우 흉할 수 있습니다.
00:33:28.16 신경섬유종증 유전자 결실의 돌연변이로 인한 것입니다.
00:33:35.21 그리고 예를 들어 GAP와 NF1에 의한 GTP 가수분해 메커니즘에 대해 연구할 때
00:33:43.00 베를린에 있는 Charite Clinic의 동료가 우리에게 와서 그가
00:33:48.03 35세의 나이로 사망하고 거기에 세 명의 아들이 있는 여성 환자
00:33:55.20 또한 질병이 있습니다. 그리고 그는 환자의 혈액과 종양 자체를 분석했습니다.
00:34:04.22 그는 신경섬유브로민의 서열에 돌연변이가 있다는 것을 발견했습니다
00:34:11.29 여기서 아르기닌이 프롤린으로 돌연변이됩니다. 아래에 있는 아르기닌이 프롤린으로 돌연변이된 것을 볼 수 있습니다.
00:34:17.13 그리고 촉매성 아르기닌이 아니었다면 분명히 말하지 않았을 것입니다.
00:34:21.19 촉매적 아르기닌에 돌연변이가 있는 것으로 밝혀졌습니다.
00:34:25.23 이제 제가 전에 보여드린 GTPase 반응을 하면
00:34:30.09 일반 NF1에는 파란색 곡선이 있습니다.
00:34:37.17 형광의 증가와 가수분해의 감소를 의미합니다.
00:34:43.03 그리고 이제 R에서 P로 이 돌연변이를 취하면 복잡한 형성을 의미하는 증가가 있습니다.
00:34:48.03 하지만 가수분해가 없고 그 동안 우리가 분석한 또 다른 환자가 있습니다
00:34:53.16 다시 아르기닌을 다른 것으로, 이 특별한 경우에는 Q,
00:34:58.09 Ras에서 GTP를 가수분해하는 능력의 차단으로 이어집니다.
00:35:02.17 필수 아르기닌의 돌연변이가 신경섬유종증이라는 질병으로 이어집니다.
00:35:08.16 또한, 나는 뉴로피브로민에 다른 많은 돌연변이가 있음을 지적해야 합니다.
00:35:13.22 또한 많은 다른 환자에서 표현형적으로 매우 다른 질병을 유발합니다.
00:35:20.26 이제 다른 시스템을 소개하겠습니다.
00:35:24.06 생화학적 관점에서 뿐만 아니라 다른 질병의 관점에서도 흥미롭습니다.
00:35:29.11 곧 가겠습니다.
00:35:33.03 그래서 제가 이야기할 것은 Rap이라는 분자에 대해 분명히 동족 RasGAP를 가지고 있습니다.
00:35:40.16 그리고 Rap은 Ras의 가까운 동족체이며 이름은
00:35:44.05 Rap이 Ras Proximate의 약자이기 때문에 Ras와 매우 유사하다는 사실입니다.
00:35:49.07 Ras의 가까운 동족체로 간주되었지만 완전히 다른 역할을 합니다.
00:35:55.14 GDP와 GTP 사이에는 분명히 동일한 주기가 있습니다. 그래서 그것은 분자 스위치로 작동합니다.
00:36:02.00 그러나 그것은 Ras와 같은 증식 또는 분화와 관련이 있는 것이 아니라 오히려
00:36:06.10 그것은 인테그린 활성화 또는 혈소판 활성화 또는 다른 것들에 관여합니다.
00:36:11.19 랩의 생물학은 완전히 다릅니다.
00:36:14.17 생화학이 흥미로운 이유는 Rap이 유일한 동족체라는 것입니다.
00:36:22.12 또는 위치에 글루타민이 없는 Ras 슈퍼 패밀리의 유일한 구성원
00:36:27.18 여기서 Ras의 글루타민 61은 GTP 가수분해에 관여합니다.
00:36:33.01 그래서, 우리가 절대적으로 중요한 GTP 가수분해라고 생각했던 잔류물을 놓치고 있습니다.
00:36:39.18 그리고 분명히 질문은 왜 그러하며 RapGAP은
00:36:42.25 그런 다음 이 시스템에 대해 작업하고 반응을 어떻게 자극합니까?
00:36:48.29 우선 RapGAP를 소개하겠습니다.
00:36:52.24 여기에는 5개가 표시되어 있지만 인간 게놈에는 더 많습니다.
00:36:57.23 하지만 이 5개의 RapGAP는 모두 매우 상동성인 도메인을 포함합니다.
00:37:04.02 여기에서 밝은 파란색과 진한 파란색 염색으로 표시됩니다.
00:37:08.09 밝은 파란색이 진한 파란색과 약간 다릅니다.
00:37:12.05 구조를 볼 때 설명하겠습니다.
00:37:13.21 다시 말하지만, 이 5개의 모든 RapGAP의 도메인 구성은 다소 다릅니다.
00:37:17.25 그것은 그들이 아마도 다른 생물학적 맥락에서 그들의 일을 하고 있다는 것을 의미합니다.
00:37:23.04 또한 흥미로운 이유는 진한 파란색 상동성 영역이
00:37:28.10 또한 Tuberin이라는 단백질에 보존됨
00:37:30.17 이것은 내가 마지막에 이야기할 질병을 의미합니다.
00:37:34.03 그래서 그 반응을 보는 것도 흥미로웠습니다.
00:37:37.06 그리고 그 반응을 살펴보는 것이 흥미로운 세 번째 이유는 다음 슬라이드에 나와 있습니다.
00:37:42.19 하지만 그 전에 먼저 우리가 하는 일을 다시 보여드리겠습니다. 정지 흐름 형광 분석입니다.
00:37:48.23 우리는 이 반응을 생화학적 방식으로 볼 수 있는 시스템을 개발했습니다.
00:37:53.12 돌연변이와 반응 속도 등을 분석합니다.
00:37:58.13 다시 여기에서 Rap-GTP가 RapGAP와 상호 작용합니다.
00:38:03.20 복잡한 형성으로 인한 크고 빠른 형광 증가를 얻습니다.
00:38:07.28 및 GTP 가수분해 및 생성물의 해리로 인한 감소.
00:38:12.25 그리고 다시 1초 후에 모든 것이 끝났습니다.
00:38:16.03 RapGAP가 없으면 전체 반응에 몇 시간이 걸립니다.
00:38:19.25 다시 말해서, 우리는 다시 10^5 반응의 자극을 받았습니다.
00:38:23.15 하지만 이것이 생화학적으로나 기계적으로 흥미로운 시스템인 이유는,
00:38:29.09 RapGAP에는 보존된 아르기닌이 많이 있으며
00:38:35.00 우리는 그들 중 하나가 시스템에 아르기닌 핑거를 제공하는 데 관여할 것이라고 생각했습니다.
00:38:39.06 사실, 우리는 그들 모두를 알라닌으로 돌연변이 시켰습니다
00:38:42.06 그리고 그들 중 누구도 여기에서 볼 수 있는 것처럼 활동에 극적인 영향을 미치지 않습니다.
00:38:48.02 따라서 최악의 반응은 여전히 ​​0.5/초에 가깝습니다.
00:38:52.02 즉, 아르기닌을 돌연변이시킬 때 극적인 효과가 없습니다
00:38:55.29 반응에 아르기닌 핑거가 관여하지 않을 가능성이 있습니다.
00:39:00.23 두 개의 잔기, 즉 고유의 글루타민과 트랜스의 아르기닌 핑거
00:39:09.04 Ras와 Rho 및 다른 사람들이 중요한 촉매를 만드는 것은 이 시스템에 없습니다.
00:39:17.05 그것은 전체 화학이 완전히 달라야 함을 의미합니다.
00:39:21.15 그래서 우리는 시스템의 FTIR을 다시 살펴보았고
00:39:26.07 구조가 약간 달라도 기본적으로 동일한 기능을 보여줍니다.
00:39:31.16 기본 기능은 감소가 속도 제한인 Pi 중간체가 있다는 것입니다.
00:39:37.23 반응과 화학적으로 다소 다르지만
00:39:41.27 다른 흡수 스펙트럼에서 알 수 있듯이, 실제로 동역학적으로 가장 중요한 중간체입니다.
00:39:50.11 하지만 흥미로운 점은 이 특정 사례에서, RapGAP 사례에서,
00:39:56.10 그 동안 다른 시스템에서도 발견되었습니다.
00:39:58.27 GTPase 반응이 가역적이라는 것입니다.
00:40:01.29 내리막 반응이기 때문에 일종의 미친 소리처럼 들립니다.
00:40:05.06 GDP와 Pi 및 전체 시스템을 취하면 GTP를 만들 수 없습니다.
00:40:09.22 하지만 반응을 분석하면
00:40:13.05 이 검은 점으로 표시된 일반 물 대신 O18 물을 사용하여
00:40:17.23 반응에서 가수분해가 일어나면 GDP와 Pi를 얻을 것으로 예상할 수 있습니다.
00:40:23.27 O18 산소로 표시된 인산염 하나와 O18 산소로 표시된 산소 하나가 있습니다.
00:40:30.12 하지만 O18 산소 1개로 Pi를 얻는 대신 O18 산소 2개로 Pi를 얻습니다.
00:40:36.24 여기에 3개의 O18 산소가 있고 4개의 O18 산소가 질량 분석으로 분석되었습니다.
00:40:42.11 질량 분광법으로 분석한 이 네 가지 제품을 모두 어디서 구할 수 있는지 알 수 있습니다.
00:40:49.27 어떻게 이런 일이 발생합니까?
00:40:51.09 단백질에 이 긴 수명의 중간체가 있기 때문에 발생합니다.
00:40:56.00 GDP 및 Pi, 활성 사이트에 앉아 제품으로 이동하기 전에
00:41:03.10 이제 감마 인산염에 하나의 산소로 GTP를 만들기 위해 역반응을 합니다.
00:41:08.15 이제, O18 물과 다시 반응하면 두 번째 O18이 제품에 통합됩니다.
00:41:15.27 그리고 다시 발생하면 세 번째와 네 번째입니다.
00:41:18.16 따라서 전반적인 반응은 내리막이지만
00:41:22.12 효소에 대해 역반응을 일으키고 있습니다.
00:41:24.15 그리고 Pi가 출시되면 절대 얻을 수 없습니다.
00:41:28.21 역반응에 대한 활성화 에너지가 너무 높기 때문입니다.
00:41:33.18 그래서 우리는 RapGAP의 구조도 해결했습니다.
00:41:37.06 2개의 도메인 구조입니다. 지금 왼쪽에 보이는 하나의 도메인은
00:41:44.07은 촉매 영역입니다. 제가 보여드린 상동성 다이어그램의 진한 파란색 영역입니다.
00:41:49.01 그리고 연한 파란색은 촉매에 중요하지 않은 이량체화 영역입니다.
00:41:53.08 하지만 단백질을 이합체화하기 위해 존재합니다
00:41:56.18 우리가 정말로 모르는 이유가 무엇이든.
00:42:00.13 촉매 영역을 분석할 때 분명히 다음과 같이 자문하게 됩니다.
00:42:03.10 보존된 잔류물은 무엇이며 그 중 촉매 작용에서 중요한 역할을 하는 것은 무엇입니까?
00:42:08.04 제가 여기에 표시한 보라색 나선은 가장 잘 보존된 지역입니다.
00:42:12.00 그래서 이 나선에 있는 잔류물이 어떻게든 촉매 작용에 관여할 가능성이 있습니다.
00:42:18.05 그리고 실제로, 이들 중 많은 부분을 돌연변이시킬 수 있고 특정 효과를 볼 수 있습니다.
00:42:21.12 하지만 가장 극적인 효과는 돌연변이를 일으킬 때 발생합니다.
00:42:25.01 N290, 그래서 아스파라긴은 이 촉매 나선에 앉아 있습니다.
00:42:29.08 이를 변형하면 다음과 같은 결과가 나타납니다.
00:42:33.00 그래서 우리는 그것을 Asn-Thumb이라고 부르며 Arginine Finger에 차이를 만듭니다.
00:42:39.03 이것은 Asn-Thumb이고 우리가 왜 Asn-Thumb이라고 부르는지 곧 알게 될 것입니다.
00:42:44.26 그래서, 우선 제가 말씀드린 돌연변이를 보시면,
00:42:48.27 그래서 N290A 돌연변이를 가지고 반응을 분석하면,
00:42:55.09 이 형광 정지 흐름 분석, 당신은 야생형이 복합물을 만드는 동안
00:43:00.25 그런 다음 제품으로 붕괴됩니다.
00:43:02.26 여기에서 돌연변이는 복합물을 만듭니다. 그건 그렇고, 이것은 야생형의 경우보다 더 촘촘합니다.
00:43:09.15 하지만 가수분해가 전혀 없습니다.
00:43:11.07 반응은 계속됩니다. 그것은 거기에 머물고 결코 내려가지 않습니다.
00:43:14.21 반면에 H287과 같은 돌연변이를 알라닌으로 만들면
00:43:20.22 형광이 여기 아래에 있기 때문에 복잡한 형성이 없다는 것을 알 수 있습니다.
00:43:24.04 결합할 수 없기 때문에 반응이 죽은 것입니다.
00:43:27.08 그러나 적색 반응은 이것이 중요한 촉매 잔류물이라고 생각하기 때문에 처리됩니다.
00:43:32.12 생화학만 보면 그렇게 생각합니다.
00:43:35.15 분명히, 그것이 하는 일을 알기 위해서는 구조를 다시 풀어야 합니다.
00:43:38.26 우리가 했습니다. Rap-RapGAP 콤플렉스입니다.
00:43:43.15 그리고 여기 빨간색과 초록색은 RapGAP이고 파란색은 Rap입니다.
00:43:49.20 그리고 GTP가 보입니다. 하지만 자세히 보시면 아시겠지만,
00:43:54.02 RapGAP의 빨간색 촉매 영역에서 가리키는 것이 있다는 것입니다.
00:43:59.06 활성 부위로 들어가게 하면 아스파라긴입니다.
00:44:01.17 분명히, 그것은 내가 이야기한 아스파라긴입니다.
00:44:04.20 랩의 활성 사이트를 찌릅니다. 이것이 우리가 Asn-Thumb이라고 부르는 이유입니다.
다른 시스템의 아르기닌 핑거와 관련하여 00:44:08.28.
00:44:12.27 그리고 활성 사이트에서 일어나는 일을 자세히 살펴보면,
00:44:17.02 Ras 단백질의 세 가지 다른 구조와 동족 GAP와 비교하면
00:44:26.19 Ran 및 RanGAP, Ras 및 RasGAP, Rho 및 RhoGAP,
00:44:31.18 여기서 Rho와 RhoGAP는 Rittinger et al. 다른 구조는 우리의 것입니다.
00:44:35.14 다른 3개, 이 3개의 구조가 여기 있는 것을 알 수 있습니다.
00:44:40.12 촉매수를 가리키는 글루타민이 있고,
여기에 표시된 감마 인산염을 공격하는 00:44:44.29,
00:44:47.09는 불화알루미늄,
00:44:50.01 전달되는 감마 인산염을 모방하는 전이 상태입니다.
00:44:54.08 그리고 여기 빨간 구조는 글루타민 61 대신에 트레오닌을 가지고 있습니다
00:45:00.19 활성 사이트에서 멀리 가리키는 것은 촉매 작용과 관련이 없습니다.
00:45:04.01 대신, 여기 보라색 나선이 이 아스파라긴을 삽입하는 것을 볼 수 있습니다.
00:45:09.19 다른 사람들이 글루타민을 가지고 있는 바로 그 위치에 활성 부위로.
00:45:14.23 여기서 차이점이 있습니다: 다른 세 구조에는 글루타민이 있는데, 이는 cis로 표시됩니다.
00:45:19.29 그리고 Rap과 RapGAP에는 트랜스에 아스파라긴이 있습니다.
00:45:23.17 즉 촉매수를 안정화시키는 것과 같은 역할을 합니다.
00:45:30.04 그리고 단백질의 표면을 보면,
00:45:34.01 이것은 표면 표현으로 표시된 랩 표면입니다.
00:45:39.07 여기에 추가된 것은 RapGAP의 나선일 뿐입니다.
00:45:43.09 표면에 앉아서 이 아스파라긴을 활성 부위에 삽입합니다.
00:45:48.13 그래서 감마 인산염은 그 구멍에서 정점을 찍습니다.
00:45:50.08 그리고 RapGAP이 실제로 하는 일은 이 Asn의 나선에 있는 것입니다. 활성 사이트에 넣습니다.
00:45:57.17 그리고 그것만으로도 적어도 화학적 의미에서,
00:46:03.03 GTPase 반응을 10^5배 자극하는 역할을 합니다.
00:46:07.10 돌연변이를 일으키면 여전히 잘 결합되지만 가수분해는 전혀 없기 때문입니다.
00:46:11.22 그래서 우리는 항-Ras 약물 디자인의 미래에 대해 다시 생각하게 됩니다.
00:46:18.02 그러한 잔류물을 활성 부위에 삽입하는 것이 전부라면,
00:46:22.11 화학적 관점에서 볼 때 그것은 가능해야 합니다.
00:46:24.24 하지만 우리는 분명히 올바른 방식으로 결합하는 분자를 개발해야 합니다
00:46:28.12 표면에 도달하는 것은 그렇게 쉬운 일이 아니며 우리는 여전히 할 수 있다고 생각하고 있습니다.
00:46:35.15 이것은 다시, 그것으로 돌아가는 것입니다.
00:46:38.00 항암제 표적에 대한 접근으로,
00:46:42.03 발암성 Ras의 가수분해를 유도하는 분자를 찾아봅시다.
00:46:46.20 그리고 우리가 RapGAP으로 관찰한 바에 따르면 우리는 그것이 이루어질 수 있다는 희망을 가지고 있다고 생각합니다.
00:46:54.26 그리고 Rap-RapGAP 시스템으로 작업하는 세 번째 이유는
00:47:03.05 그것은 양성 종양인 결절 경화증이라는 질병과 관련이 있습니다.
00:47:06.19 사람들은 많은 장기에 과오종을 가지고 옵니다.
00:47:09.16 하지만 가장 분명한 특징과 이름의 유래는
00:47:14.07 사람들은 뇌의 NMR을 수행할 때
00:47:16.29 뇌의 NMR에서 볼 수 있는 뇌의 경화성, 결절성 종류입니다.
00:47:24.17 사람들은 Tuberin과 Hamartin이라는 두 가지 단백질에 돌연변이가 있습니다.
00:47:30.22 그리고 전에 보여드린 것처럼 Tuberin은 높은 상동성을 가지고 있습니다.
00:47:34.22 이 짙은 파란색 영역의 RapGAP에 연결합니다. 이것은 촉매 영역을 의미합니다.
00:47:39.07 이제 예를 들어 결절성 경화증의 환자 돌연변이를 보면
00:47:44.23 Tuberin에서 발생합니다.
00:47:47.00 그리고 이것은 다른 RapGAP 시퀀스의 정렬이며 Tuberin 시퀀스와 정렬됩니다.
00:47:53.27 가장 많이 보존된 지역은 다시,
00:47:57.09 여기 (빨간색) 촉매 나선이 있는 것입니다.
00:48:01.08 그리고 결절성 경화증 환자의 돌연변이 중 하나는
00:48:04.22 (많은 사람들이 실제로 그 돌연변이를 가지고 있음) 켜져 있습니다
00:48:07.06 우리가 알고 있는 이 아스파라긴은 중요한 촉매 잔류물입니다.
00:48:11.08 이것은 우리가 전에 본 것의 또 다른 버전입니다
00:48:14.21 결절성 경화증이라는 질병에서 중요한 촉매 잔류물이 돌연변이됩니다.
00:48:21.19 마지막 5분 동안 다른 질병을 알려드리겠습니다.
00:48:25.22 단지 Ras와 Rap 시스템이 아니라는 것을 확인하기 위해
00:48:28.28 GTP를 가수분해하지 못해 매우 다양한 질병을 유발하는 질병이 많다는 것을 알 수 있습니다.
00:48:35.07 이것이 색소성 망막염입니다.
00:48:38.28 사람은 망막에 색소가 있습니다. 이름에서 따온 것입니다.
00:48:42.28 그리고 그들은 시력을 잃고 주변 시력을 잃습니다.
00:48:47.00 이 건물을 보는 정상인이고 질병에 걸린 환자입니다.
00:48:52.15 점점 더, 점차적으로 주변 시야를 잃게 됩니다.
00:48:56.00 그리고 질병이 완전히 진행된 후 완전한 시력을 잃습니다.
00:49:01.19 색소성 망막염에는 많은 유전자가 돌연변이되어 있습니다
00:49:06.12 RP12x 등으로 불리는 것들입니다.
00:49:09.28 그리고 RP2라는 형식이 있습니다.
00:49:13.03 그것은 사람들에게 돌연변이가 있는 X-연관 질병입니다. 단백질에 많은 점 돌연변이가 있습니다.
00:49:21.16 우리는 다음과 같은 단백질의 구조를 결정했습니다.
00:49:24.24 이것은 베타 나선 도메인이고 이것은 또 다른 도메인입니다.
00:49:27.20 그리고 분석한 많은 돌연변이를 볼 수 있습니다.
00:49:31.06 당신이 보는 것은 대부분의 돌연변이가
00:49:37.16 내부에 있기 때문에 구조를 결정하거나 엉망으로 만듭니다.
00:49:41.24 단백질의 소수성 코어와
00:49:45.04 그들은 촉매 작용이나 이 단백질의 상호작용에 아무 것도 하지 않습니다.
00:49:50.19 그러나 여기에 표시된 몇 가지 돌연변이가 있습니다. 예를 들어,
00:49:54.01 E138G 또는 R118에서 H, K 또는 C로. 따라서 이러한 잔류물은 용액을 가리킵니다.
00:50:03.27 그래서 당신은 그들이 단백질의 상호 작용에 중요한 일을 한다고 생각할 것입니다
00:50:08.20 또는 무언가에서--그들은 이 단백질이 일반적으로 하는 일에 관여합니다.
00:50:14.20 그래서 우리는 다시 Arl3 사이의 복합체 구조를 풀었습니다.
00:50:19.13 그래서 우리는 RP2가 다른 Ras 유사 단백질인 Arl3과 상호작용한다는 것을 알았습니다.
00:50:24.26 Arf 관련 단백질이기 때문에 Arl이라고 합니다.
00:50:28.04 그리고 우리는 그 구조를 풀었습니다. 여기 이 물건이 보라색으로 표시된 RP2임을 알 수 있습니다.
00:50:37.25 그리고 녹색으로 표시된 것은 GTP 바인딩 형식의 Arl3입니다.
00:50:41.25 그리고 당신이 보는 것은 다시 아주 자세히 보면,
00:50:44.26 Arl의 활성 부위를 가리키는 바로 여기에 RP2의 잔류물이 있음을 알 수 있습니다.
00:50:52.10 RP2가 무엇을 하는지 몰랐지만 구조를 풀었을 때
00:50:55.17 GAP 냄새가 나는 것을 즉시 알 수 있었습니다.
00:50:59.18 아르기닌 핑거를 다른 단백질의 활성 부위에 넣습니다.
00:51:05.08 활성 사이트를 자세히 살펴보면 이것이 GDP라는 것을 알 수 있습니다.
00:51:10.28 이것은 알루미늄 플루오라이드입니다. 이것은 Arl3의 글루타민입니다.
00:51:15.14 그리고 이들은 RP2--Q116, R118, E138의 3개 잔기입니다.
00:51:21.26 그리고 분명히, 이 모든 잔류물은 색소성 망막염에서 돌연변이됩니다.
00:51:27.15 그리고 당신은 아르기닌이 지금까지 여러 번 본 것과 같은 일을 하고 있다는 것을 알 수 있습니다.
00:51:32.22 그리고 돌연변이되면 이 다른 잔기와 세 잔기 모두에 의해 안정화됩니다.
00:51:38.10 RP2의 GAP 활동을 엉망으로 만듭니다.
00:51:41.26 여기 구조는 단백질이 하는 일을 알려줍니다.
00:51:44.19 함수에 대한 정보가 없었고 구조가 정확히 이것이 Arl3의 GAP임을 알려줍니다.
00:51:53.17 이제 내가 당신에게 말한 것에서 결론을 내리겠습니다.
00:52:00.12 우선 가장 중요한 종양 유전자이기 때문에 Ras 자체에 대한 결론일 것입니다.
00:52:06.14 이것은 불완전한 효소이며 GTP를 매우 빠르게 가수분해할 수 없습니다.
00:52:11.09 그러나 스위치 II와 글루타민 61을 안정화시키는 RasGAP가 옵니다.
00:52:16.10 중요한 구조적 촉매 요소이며 활성 부위에 아르기닌 핑거를 공급하기도 합니다.
00:52:23.04 Gln1 돌연변이가 있습니다. 글루타민 61의 모든 돌연변이는 종양 유전자입니다.
00:52:28.29 촉매 잔류물(시스템)을 놓치기 때문입니다.
00:52:33.00 GTP 가수분해를 수행하기 위해 입체적으로 손상된 글리신 돌연변이가 있습니다.
00:52:38.21 아르기닌 손가락이
00:52:42.06 글리신 12의 돌연변이가 있을 때 적절한 위치로 이동할 수 있습니다.
00:52:46.04 나는 또한 강력하게 결합된 GDP-Pi 중간체가 있다는 것을 보여주었습니다.
00:52:50.02 그리고 시스템의 Pi 릴리스는 속도 제한이 됩니다.
00:52:54.28 GAP가 없으면 화학적 절단 반응이 속도 제한 단계입니다.
00:53:00.23 두 번째 결론은 Ras 슈퍼패밀리에 더 일반적입니다.
00:53:05.01 Ras 단백질은 모두 불완전한 효소입니다.
00:53:07.20 그들은 모두 GTP를 매우, 아주 천천히 가수분해합니다.
00:53:09.27 동족 GAP가 있습니다.
00:53:12.02 각 하위 패밀리 단백질과 때로는 하위 패밀리 내의 단백질도,
00:53:16.24에는 촉매 작용을 위해 빠른 GTP 가수분해에 필요한 특정 동족 GAP가 있습니다.
00:53:22.17 일부 GAP는 아르기닌 손가락을 제공합니다
00:53:25.02 이제 Ras, Ran, Rho 등 다양한 예를 보여 드리겠습니다.
00:53:30.15 RabGAP는 아그리닌과 Gln을 제공합니다.
00:53:34.23 일부 GAP는 Asn 엄지손가락을 제공합니다.
00:53:37.00 RapGAP의 예를 보여 드렸고 Tuberin도 아마 같은 일을 할 것입니다.
00:53:41.03 Pi 릴리스는 매우 자주 속도를 제한합니다.
00:53:44.10 그리고 훨씬 더 중요한 것은, 그것이 전체 강연에 대한 제 메시지입니다.
00:53:47.19 교란된 GTPase 반응이 여러 질병과 관련되어 있다는 것입니다.
00:53:53.24 암, 신경섬유종증, 결절성 경화증,
00:53:58.03 색소성 망막염과 제가 이야기하지 않은 더 많은 것들이 있습니다.
00:54:01.07 관심을 가져주셔서 감사합니다. 그러나 나는 할 것이다.
00:54:03.00 중단하기 전에 먼저 작업을 수행한 사람들에게 감사드립니다.
00:54:07.18 제가 여러분에게 말한 가장 오래된 이야기는 Ras와 RasGAP의 이야기입니다.
00:54:11.22 연구소의 세 명의 박사후 연구원인 Reza Ahmadian, Klaus Scheffzek 및 Robert Mittal이 수행했습니다.
00:54:17.23 RapGAP 이야기는 Oli Daumke, Astrid Kramer,
00:54:23.14 파르타 차크라바르티와 안드레아 스크리마.
00:54:26.18 그리고 RP2 이야기는 Stefan Veltel과 Karin Kuhnel이 했습니다.
00:54:32.04 그리고 제가 보여드린 많은 영화는 Ingrid Vetter가 제작한 것입니다.
00:54:36.20 제 결정학 연구실도 운영하고 있습니다.
00:54:38.15 그리고 그녀는 거의 모든 프로젝트에서 매우, 매우 도움이 되었습니다.
00:54:42.13 그리고 우리는 있습니다. FTIR에서 우리는 협력하고 있습니다
00:54:46.03 보훔 대학교(University of Bochum)의 동료 Klaus Gerwert와 Carsten Kotting입니다.
00:54:51.03 관심을 가져주셔서 감사합니다.
00:54:52.10

  • 1부: 분자 스위치로서의 GTP 결합 단백질

자연이 단백질을 변형하기 위해 인산염을 선택한 이유

인산 에스테르 결합의 유리한 화학적 특성은 RNA와 DNA의 인접 염기를 연결하는 인산 디에스테르 결합을 생성하기 위해 진화 초기에 이용되었습니다(Westheimer 1987 과학235, 1173-1178). 유전자 코드의 고정에 이어, 인산 에스테르 변형의 또 다른 용도, 즉 단백질에서 세 가지 히드록시아미노산인 세린, 트레오닌 및 티로신의 가역적 인산화가 발견되었습니다. 진화 과정에서 인산화는 다양성과 즉시 가역성 때문에 번역 후 변형의 가장 두드러진 유형 중 하나로 등장했습니다. 단백질 인산화에 의해 생성된 인산아미노산은 다음과 같은 역할을 합니다. 새로운 천연 아미노산과 유사하지 않아 단백질 표면의 화학적 성질을 다양화하는 수단을 제공하는 화학적 실체. 단백질 연결 인산염 그룹은 분자 내 또는 분자간 수소 결합 또는 염 다리를 형성하여 아스파르테이트 또는 글루타메이트보다 아르기닌과 더 강한 수소 결합을 생성할 수 있습니다. 이온 껍질의 독특한 크기와 공유 결합된 인산염의 전하 특성은 다른 단백질의 phosphospecific-binding domains에 의한 phosphoproteins의 특이적이고 유도 가능한 인식을 허용하여 유도 가능한 단백질-단백질 상호 작용을 촉진합니다. 이러한 방식으로 인산화는 신호 전달 네트워크가 세포 외 자극에 대한 응답으로 신호를 전송할 수 있도록 하는 스위치 역할을 합니다.

1. 인산염 에스테르는 생명의 진화에 유리한 화학적 성질을 가지고 있습니다.

인산염 함유 분자는 모든 살아있는 세포의 필수 구성 요소입니다. 그렇다면 자가 복제 생명체가 진화하는 동안 인산염을 핵심 빌딩 블록으로 선택한 특별한 특성은 무엇입니까? 인은 15족 원소이므로 외부 껍질에 5개의 전자가 있습니다. 전자를 제공함으로써 인은 5개의 공유 결합을 형성할 수 있습니다. 예를 들어 4개의 산소 원자와 결합하여 인은 오르토인산염을 형성합니다. 인산염은 3개의 pKas(2.2, 7.2(에스테르로서 5.8) 및 12.4)를 가지며 물에 잘 용해되어 큰 수화된 이온 껍질을 형성합니다. 인산염은 화학적으로 다재다능하며 산 무수물뿐만 아니라 알킬 및 아릴 히드록실기와 함께 모노, 디 및 트리 에스테르를 형성할 수 있습니다. 또한, 인은 P-N(포스포르아미데이트), P-S(포스포로티오에이트) 및 P-C(포스포네이트) 결합을 형성할 수 있습니다.

인산염은 지구에 매우 풍부하며 수용성으로 인해 생명체가 진화하는 동안 쉽게 구할 수 있습니다. 인산염이 물의 주변 온도에서 안정한 에스테르와 무수물을 형성하는 능력은 생물학적 분자 생성에 이상적입니다. 인산염 에스테르와 무수물은 살아있는 유기체에서 우세하지만 포스포라미데이트, 포스포로티오에이트 및 포스포네이트는 모두 자연에서 발견됩니다. 인산 에스테르는 인산 무수물인 아데노신 삼인산(ATP)을 인산 공여체 및 효소 촉매로 사용하여 생리학적 조건에서 쉽게 형성됩니다. 일단 형성되면 인산 에스테르는 생리학적 pH의 수용액에서 화학적으로 안정하지만 적절한 효소 촉매에 의해 쉽게 가수분해되어 원래의 OH-기와 유리 인산염을 재생합니다. 세포에서 중요한 인산 에스테르에는 핵산과 인단백질이 포함됩니다. 생물학적 인산염 무수물의 예는 ATP 및 PAPS(3'-포스포아데노신-5'-포스포설페이트)입니다. 인산염은 화학 합성에서 이탈기로 거의 사용되지 않지만 적절한 효소 촉매가 있는 경우 생리학적 온도에서 반응성입니다. 3개의 pKa로 인해 인산염은 생리학적 세포 내 pH인 pH 7에서 이음이온성입니다. 따라서, 포스페이트 모노에스테르 그룹은 하나의 완전한 음전하와 두 번째 음전하를 가지며, 이는 화학적 맥락에 따라 부분 또는 전체 전하일 수 있습니다. 포스페이트 디에스테르는 완전한 음전하를 유지합니다. 중요하게는, 2개의 뉴클레오시드가 포스페이트 디에스테르에 의해 연결될 때, 포스페이트는 여전히 완전히 이온화되어(pKa < 1) 인지질 막 내에 핵산을 유지하기 위해 음전하를 제공하고 또한 음이온성 친핵체에 의한 공격을 통한 가수분해로부터 에스테르 연결을 보호합니다. , 예를 들어 OH - . 인산화 단백질을 포함하여 인산 에스테르가 있는 모든 분자는 동일한 속성을 가지고 있습니다. pH 7의 물에서 인산 에스테르의 엄청난 안정성(인산 모노에스테르는 25°C에서 10 12년의 반감기를 갖는 것으로 추정됨[1])은 많은 수에도 불구하고 현저하게 안정적인 매우 긴 폴리뉴클레오티드의 형성을 허용합니다. 인산 에스테르 결합은 유전 정보의 장기 저장에 필수적인 속성입니다.

2. 인산화 및 탈인산화 반응의 에너지론

ATP 및 기타 뉴클레오사이드 삼인산의 프리바이오틱 생성은 폴리뉴클레오타이드 형성 및 유전 정보 암호화의 핵심이었습니다. 주요 에너지 저장 화합물로 ATP를 선택한다는 것은 다른 분자로 이동하기 위해 활성화된 인산염 그룹을 쉽게 이용할 수 있음을 의미했습니다. 에너지 저장 기능 때문에 ATP는 일반적으로 2에서 4mM 범위의 농도로 세포에 매우 풍부합니다. ATP는 물에 잘 녹고 생리학적 pH와 온도에서 비교적 안정하지만 α-β 및 β-γ 인산 무수물 결합에 상당한 화학 에너지를 저장하며, 각각은 약 8–12 kcal mol-1의 가수분해 자유 에너지를 갖는다. , 이온 조건에 따라. α-β 및 β-γ 무수물 결합은 모두 중요한 생물학적 반응을 유도하는 데 사용할 수 있습니다. 그러나 이러한 반응은 원칙적으로 많은 상황에서 가역적입니다. 그 이유는 알킬 및 아릴 히드록시 인산 에스테르도 비교적 높은 가수분해 자유 에너지(약 8–10 kcal mol -1 )를 갖기 때문입니다. 피로인산을 생성하는 폴리뉴클레오티드 합성과 같은 α-β 무수물 결합의 절단을 포함하는 반응은 대부분의 세포에 존재하는 풍부한 피로포스파타제 활성을 통해 비가역적으로 됩니다. 단백질 인산화와 같은 β-γ 무수물 결합의 절단을 포함하는 반응은 세포가 매우 높은 ATP/아데노신 이인산(ADP) 비율을 유지하기 때문에 주로 비가역적으로 됩니다.

인산 에스테르 결합의 에너지가 ATP β-γ 무수물 결합의 에너지와 유사하기 때문에 인산화의 에너지는 비교적 잘 균형을 이룹니다. 사실, (단백질 + ATP → P.단백질 + ADP) 반응에 대한 단백질 키나아제 평형 상수의 범위는 2에서 50이며 많은 단백질 키나아제는 ADP가 있는 상태에서 인단백질을 탈인산화하기 위해 역으로 쉽게 작용하여 ATP를 생성합니다. -4]. 따라서 세포에서 인산화는 높은 ATP/ADP 비율에 의존하여 역반응을 방지합니다. 인산 에스테르는 화학적으로 다소 안정하지만 생리학적 조건에서 적절한 효소 촉매에 의해 쉽게 가수분해될 수 있습니다. 인산염 모노에스테르의 상대적으로 높은 에너지는 일단 가수분해되면 유리 인산염과의 반응에 의한 인분해를 통해 재형성될 수 없으므로 탈인산화를 비가역적으로 만듭니다.

3. 단백질 인산화의 진화

인산염 에스테르 결합의 유리한 화학적 특성은 RNA와 DNA의 인접 염기를 연결하는 인산염 디에스테르 결합에 의해 예시되는 바와 같이 진화 초기에 이용되었습니다[5]. 20개의 공통 아미노산에 대한 유전 코드가 고정되면 인산 에스테르 변형에 대한 두 번째 가능한 용도, 즉 조절 메커니즘으로서 단백질의 세린(Ser), 트레오닌(Thr) 및 티로신(Tyr) 잔기의 인산화가 등장했습니다. 진화 과정에서 인산화는 다용성과 즉시 가역성으로 인해 번역 후 변형(PTM)의 가장 두드러진 유형 중 하나가 되었습니다. 단백질의 20개 아미노산 중 9개에서 발생할 수 있는 단백질 인산화는 생리학적 조건에서 ATP를 인산 공여체로 사용하는 단백질 키나제에 의해 쉽게 촉매됩니다(구아노신 삼인산(GTP) 및 포스포에놀 피루브산(PEP)도 인산염으로 작용할 수 있음) 기증자). 인산화는 단백질 포스파타제에 의한 효소 촉매 가수분해를 통해 쉽게 역전되며, 이는 반응 속도를 수천 배 가속화합니다.

단백질의 인산화는 진핵생물에서 가장 흔한 PTM 중 하나입니다. Ser, Thr 및 Tyr의 인산 에스테르는 진핵생물에서 우세하지만 6개의 다른 아미노산의 인산화는 화학적으로 가능합니다(아르기닌(Arg), 라이신(Lys), 히스티딘(His), 시스테인(Cys), 아스파르테이트(Asp) 및 글루타민( Glu)), 그리고 많은 경우에 발생하는 것으로 알려져 있습니다. '고에너지' 포스포라미데이트 결합을 생성하기 위한 His, Lys 및 Arg의 인산화는 프리바이오틱 조건에서 중요했을 수 있습니다. 실제로 Arg 인산염은 식물에서 에너지 저장 화합물로 사용됩니다. Phosphohistidine(P.His)은 화학적으로 불안정하고 pH 7의 수용액에서 상대적으로 반감기가 짧지만 His 인산화는 고등 진핵생물에서 조절 기전으로 사용된다[6]. 또한, P.His는 촉매 바이오센서 단백질이 Asp의 반응 조절 단백질을 인산화하여 신호를 전달하는 다수의 원핵생물 2성분 신호전달 시스템에 의해 단백질로 인산염을 전달하는 중간체로 사용됩니다. 전사 인자의 활성화로 막에서의 세포외 입력. 이러한 시스템에서 신호 입력에 대한 응답으로 바이오센서에서 생성된 P.His 포스포라미데이트 결합의 높은 에너지는 Asp의 β-COOH 그룹에 인산염의 결합을 유도하여 혼합 무수물 결합을 형성합니다.

4. 단백질 인산화가 중요한 이유는 무엇입니까?

단백질에서 포스포아미노산의 중요한 특징은 다음과 같이 작용한다는 것입니다. 새로운 천연 아미노산과 유사하지 않아 단백질 표면의 화학적 성질을 다양화하는 수단을 제공하는 화학적 실체. 특히, 큰 수화 껍질과 1보다 큰 음전하를 가진 인산염 그룹은 카르복실 측쇄가 단일 음전하와 더 작은 수화 된 아미노산을 갖는 유일한 음전하 아미노산 Asp 및 Glu와 화학적으로 상당히 다릅니다. 인산염보다 껍질. 이러한 이유로 Asp 또는 Glu 잔기의 인접 쌍이 단일 Asp 또는 Glu보다 더 나은 phosphomimetic 돌연변이 역할을 할 수 있다고 제안되었습니다. 이는 국소 이중 음전하를 생성하기 때문입니다[7].

단백질 연결 인산기는 분자 내 또는 분자간 수소 결합 또는 염 다리를 형성할 수 있습니다. 특히, 인산기는 생리학적 pH에서 이중으로 하전된 인산기에 직접 수소 결합을 만들 수 있는 단단하고 평면 구조를 갖는 Arg의 구아니디노기와 상호작용하는 데 매우 적합합니다. 더 높은 음전하 밀도와 더 큰 수화 껍질 때문에 포스포아미노산은 Arg가 있는 Asp 또는 Glu보다 더 강하고 안정적인 수소 결합과 염 다리를 형성합니다[8]. 이러한 방식으로 단일 인산염은 분자내 또는 분자간 효과를 발휘할 수 있습니다. 단백질 포스페이트는 다른 단백질 또는 소분자의 기능 또는 상호작용을 조절하기 위해 입체적으로 또는 이온적으로 작용할 수 있거나, 또는 보다 일반적으로 단백질 단량체 내에서 형태적 변화 또는 단백질 다량체 내에서 알로스테릭 전이를 유도하기 위해 작용할 수 있다. 공유 결합된 포스페이트의 독특한 크기와 전하 특성은 또한 다른 단백질의 인특이적 결합 도메인에 의한 인단백질의 특이적이고 유도 가능한 인식을 허용하여 유도 가능한 단백질-단백질 상호작용을 촉진합니다. 실제로, 다른 단백질에 대한 인의존성 결합 부위를 생성하는 특정 서열 맥락 내의 포스페이트의 능력은 틀림없이 단백질 인산화의 가장 중요한 기능입니다. 인산화 의존성 단백질 상호작용은 세포 내 신호 전달에 중요하지만, 인산화는 또한 단백질의 세포내 위치 변화를 일으키거나 포스포데그론을 생성하여 유비퀴틴 의존성 단백질 분해를 유발할 수 있습니다.

5. 단백질 변형을 위해 인산염이 다른 분자보다 선호되는 이유는 무엇입니까?

주기율표에서 인 주변의 여러 원소는 폴리옥시음이온을 형성합니다. 황산염(황은 인 다음으로 16족에 속함)은 가수분해의 높은 자유 에너지를 갖는 아릴 및 방향족 하이드록시 에스테르를 형성할 수 있으며 분비된 단백질의 황산화된 Tyrs를 포함하여 생물학에서 황산염 에스테르의 예가 있습니다. 그러나 황산염의 에너지는 그다지 바람직하지 않으며 황산염에는 이온화 가능한 산소가 두 개뿐이며 둘 다 pH 2 미만의 pKa를 가지므로 황산염 모노에스테르는 항상 단일 음전하를 유지합니다. 더욱이, 알킬 설페이트 디에스테르는 음전하가 부족할 뿐만 아니라 불안정하고 생물학적 분자(예: 메틸 메탄설포네이트)를 알킬화하는 바람직하지 않은 특성을 가지고 있습니다. 오르토실리케이트(실리콘은 인 다음으로 14족에 속함)도 지구에 매우 풍부하지만 가장 낮은 pKa는 9.5이며 에스테르는 수용액에서 극도로 불안정합니다.

화학적 관점에서 비산염은 인산염에 대한 가장 그럴듯한 대안입니다. 인과 같은 비소는 15족에 속하며 비소(V)는 인산염과 유사한 에스테르 형성 특성과 pKas(2.1, 6.9 및 11.5)를 가지고 있습니다. 인산염과 마찬가지로 비산염은 모노, 디 및 트리 에스테르를 형성할 수 있습니다. 그러나 비산 트리에스테르와 디에스테르는 수용액에서 매우 불안정합니다(비산 트리에스테르의 반감기는 pH 7 및 실온의 물에서 0.02초 미만이며 디에스테르는 훨씬 덜 안정적입니다)[9]. 마찬가지로, 아데노신 트리아르세네이트와 같은 핵산 전구체는 매우 불안정할 것으로 예상됩니다. 또한, 비산염은 시스테인 티올 그룹과의 반응을 포함하여 바람직하지 않은 화학적 특성을 가지고 있습니다. As(V)는 비소 독성의 기초가 되는 As(III) 트리티올레이트 및 산화된 디티올을 생성하기 위해 유리 티올에 의해 쉽게 환원됩니다. 마지막으로 As-O 결합 길이는 P–O 결합 길이보다 약 10% 더 길며 결과적으로 반지름은 의 반지름보다 약 10% 더 큽니다. 또한 P–O 산소 원자의 부분 음전하는 As–O보다 약 6% 더 큽니다. 이러한 화학적 차이는 결합으로 비산 디에스테르를 사용하는 거대분자의 구조와 특성을 변경합니다.

이러한 이유로 미국 캘리포니아 모노레이크에서 분리된 할로박테리움이 인산염 대신 비산염을 사용할 수 있다는 최근 보고는 놀랍다[10]. 비산염은 방사성 비산염으로 표지화하고 다양한 유형의 물리적 분석을 기반으로 이 유기체의 DNA, RNA, 지질 및 단백질(전체의 80%)에 통합되어 있다고 주장합니다. 그러나, DNA 분석은 인산염이 첨가되지 않은 비산염 배지에서 성장한 세포에서 분리된 세포의 DNA에 여전히 인산염이 있음을 보여주었습니다. 이는 아마도 성장 배지에 사용된 화학 물질의 오염된 인산염에서 유래한 것으로 추정됩니다. DNA에 비산 디에스테르 결합이 있거나 단백질이 Ser, Thr 및 Tyr에서 비소화된다는 직접적인 증거는 제시되지 않았습니다.비산염이 인산염을 대체하여 생명을 유지하고 에스테르화를 통해 단백질을 변형할 수 있는 정도를 결정하려면 이 유기체에 대한 추가 분석이 필요합니다[9].

6. 코다

인산염 그룹은 단백질에 부착될 때 중요한 생물학적 기능을 조절하기 위해 이용될 수 있는 특별한 특성을 가지고 있습니다. 인산기는 유도성 단백질-단백질 상호작용을 촉진하는 스위치 역할을 하여 신호 전달 네트워크가 세포외 자극에 대한 응답으로 일시적인 신호를 전송할 수 있도록 합니다. 인산염은 생물학적 고분자 형성, 특히 단백질 변형에 거의 이상적인 화학적 특성을 가지고 있습니다. 우리가 알고 있는 생명체는 인산염 없이는 진화할 수 없었습니다.


감사의 말

저자는 다음 개인과 기관에 감사를 표하고 싶습니다.

DNA-단백질 상호작용 실험(그림 6) Karsten Meyenberg 및 Ulf Diederichsen 교수(Institut für Organische und Biomolekulare Chemie, Georg-August-Universität Göttingen, Göttingen, Germany), Geert van den Bogaart 및 Reinhard Jahn(Max-Planck-Institut für Chemie biophysikalis) 리포솜 실험(그림 7) 및 Krishna Saxena(Johann Wolfgang Goethe-Universität, Frankfurt, Germany)는 p38 억제제 및 추적자 결합 연구(무화과 삼 그리고 4). PKA의 촉매 서브유닛과 열안정성 억제제 PKI는 F.W. Herberg(University of Kassel, Germany)와 B. Zimmermann(Biaffin GmbH & Co KG, Kassel, Germany)의 친절한 선물이었습니다.그림 5) EU FP7 협업 프로젝트 Affinity Proteome(계약 222635)에서 지원합니다.

Sergey Tarasov(NCI Frederick)는 생체 분자 상호 작용 연구에 대한 유익한 토론에 감사드립니다.

에 자세히 설명된 실험 그림 6 독일 에센의 뒤스베르그-에센 대학 의료 방사선 생물학 연구소에서 수행되었습니다.

이 작업은 독일 연방 교육 연구부, Hightech Strategie "KMU-Innovativ: Biotechnologie-Biochance"(보조금 번호: FKZ 0315376)의 지원을 받았습니다.

Center for Nanoscience(CeNS)와 Nanosystems Initiative Munich(NIM)은 이 작업을 지원했습니다.


비디오 보기: რა არის პროტეინი, საკვებდანამატის (칠월 2022).


코멘트:

  1. Abell

    당신에게 추상적 사고방식

  2. Cianan

    당신은 오류를 저질렀습니다. 나는 그것을 논의 할 것을 제안한다. 오후에 저에게 편지를 보내십시오.

  3. Lachlan

    재미있는 작품이다

  4. Volkree

    Bravo, seems remarkable idea to me is

  5. Akando

    좋은 거래!

  6. Gervasio

    전문가가 아닙니까?



메시지 쓰기