정보

4.3.4: 남조류 - 생물학

4.3.4: 남조류 - 생물학


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

학습 목표

  • 비프로테오박테리아 그람음성균의 고유한 특징 설명
  • 각 범주에서 비프로테오박테리아 박테리아의 예를 제시하십시오.
  • 광영양세균의 특징을 설명하시오.
  • 광영양 박테리아 식별

그람 음성 박테리아의 대부분은 이전 섹션에서 논의한 프로테오박테리아 문에 속합니다. 생태학적으로 가장 중요한 그람 음성 문 중 하나는 시아노박테리아입니다.

크고 다양한 광영양 박테리아 그룹이 Cyanobacteria 문을 구성합니다. 그들은 세포에 포함된 엽록소에서 청록색을 얻습니다(그림 (PageIndex{5})). 이 그룹의 종은 산소 광합성을 수행하여 메가톤의 기체 산소를 생성합니다. 과학자들은 시아노박테리아가 10~20억 년 전 지구의 무산소 대기를 오늘날의 산소가 풍부한 환경으로 바꾸는 데 중요한 역할을 했다고 가정합니다.3

시아노박테리아에는 다른 놀라운 특성이 있습니다. 놀랍도록 적응력이 뛰어나 해양 및 담수 환경, 토양, 심지어 암석을 포함한 많은 서식지에서 번성합니다. 그들은 남극의 극한 온도에서도 광범위한 온도에서 살 수 있습니다. 그들은 단세포 유기체 또는 군체로 살 수 있으며, 필라멘트 형태일 수 있으며 피복 또는 생물막을 형성합니다. 그들 중 많은 수가 질소를 고정하여 분자 질소를 다른 박테리아, 식물 및 동물이 사용할 수 있는 아질산염 및 질산염으로 변환합니다. 질소 고정 반응은 이종포낭(heterocyst)이라고 불리는 특수 세포에서 발생합니다.

시아노박테리아의 광합성은 일차 광합성 색소로 식물과 조류에서 발견되는 동일한 유형의 엽록소 a를 사용하여 산소를 공급합니다. 시아노박테리아는 또한 피코시아닌(phycocyanin)과 시아노피신(cyanophycin)을 사용하는데, 이 두 가지 2차 광합성 색소는 특유의 푸른색을 나타냅니다. 그들은 phycobilisomes라고 불리는 특별한 세포 소기관과 식물의 광합성 장치와 현저하게 유사한 틸라코이드라고 불리는 세포막의 주름에 있습니다. 과학자들은 식물이 조상의 진핵 세포와 조상의 광합성 박테리아의 내공생에서 유래했다고 가정합니다.4 시아노박테리아는 생화학 분야에서도 흥미로운 연구 대상이며,5 생물 흡착제로서의 잠재력을 조사하는 연구와 함께6 및 인간 영양 제품.7

불행히도 남조류는 때때로 인간의 건강에 부정적인 영향을 미칠 수 있습니다. 다음과 같은 속 소낭포 유해한 남조류 꽃을 형성하여 수역에 조밀한 매트를 형성하고 야생 동물과 인간에게 해를 줄 수 있는 다량의 독소를 생성할 수 있습니다. 이 독소는 간 종양과 동물과 인간의 신경계 질환과 관련이 있습니다.8

요약

  • 그람 음성 비프로테오박테리아에는 분류군이 포함됩니다. 스피로헤타; NS 사이토파가, 푸소박테리움, 박테로이데스 그룹; Planctomycetes; 그리고 많은 대표자들 광영양 박테리아.
  • 스피로헤타는 길고 좁은 몸체를 가진 운동성 나선형 박테리아입니다. 그들은 문화에 어렵거나 불가능합니다.
  • 스피로헤타의 여러 속에는 매독 및 라임병과 같은 질병을 일으키는 인간 병원체가 포함되어 있습니다.
  • 사이토파가, 푸소박테리움, 그리고 박테로이데스 라는 문으로 함께 분류된다. CFB 그룹. 그들은 막대 모양의 혐기성 유기 이종 영양체 및 열렬한 발효기입니다. 사이토파가 활공 운동성을 가진 수생 박테리아입니다. 푸소박테리아 사람의 입에 서식하며 심각한 전염병을 일으킬 수 있습니다. 박테로이데스 인간의 장에 엄청난 수로 존재하며, 대부분은 상호작용적이지만 일부는 병원성입니다.
  • Planctomycetes는 발아에 의해 번식하는 수생 박테리아입니다. 그들은 큰 식민지를 형성하고 고정력을 개발할 수 있습니다.
  • 광영양 박테리아는 분류군이 아니라 햇빛 에너지를 사용하는 능력에 따라 분류되는 그룹입니다. 여기에는 프로테오박테리아 및 비프로테오박테리아뿐만 아니라 보라색 또는 녹색으로 착색된 황 및 비황 박테리아가 포함됩니다.
  • 유황 박테리아는 황 화합물을 전자 공여자로 사용하여 무산소 광합성을 수행하는 반면, 비황 박테리아는 유기 화합물(숙시네이트, 말레이트)을 전자 공여자로 사용합니다.
  • 일부 광영양성 박테리아는 질소를 고정하여 다른 유기체에 사용 가능한 형태의 질소를 제공합니다.
  • 남세균 지구 대기 형성에 중요한 역할을 했다고 생각되는 산소를 생성하는 박테리아입니다.

각주

  1. 1 R.C. Fuller et al. "탄소 대사 크롬.” 생물 화학 저널 236 (1961):2140–2149.
  2. 2 T.T. Selao et al. "비교적 단백질체 연구 로도스피릴룸 루브룸 다양한 질소 조건에서 성장했습니다.” 프로테옴 연구 저널 7 아니. 8(2008):3267–3275.
  3. 3 A. De los Rios et al. "남극 화강암 암석에 서식하는 내돌기 남조류 생물막의 초구조 및 유전적 특성." FEMS 미생물학 생태학 59번 2(2007):386–395.
  4. 4 T. Cavalier-Smith. "막 유전과 초기 엽록체 진화." 식물 과학의 동향 5 아니. 4(2000):174–182.
  5. 5 S. Zhang, D.A. 브라이언트. "시아노박테리아의 트리카르복실산 주기." 과학 334번 6062(2011):1551–1553.
  6. 6 A. Cain et al. "수은 이온을 위한 생물 흡착제로서의 남조류." 바이오리소스 테크놀로지 99호 14 (2008):6578–6586.
  7. 7 C.S. Ku et al. "식용 청록색 조류는 대식세포와 비장세포에서 NF-κB 경로를 억제하여 염증성 사이토카인 생성을 감소시킵니다." Biochimica 및 Biophysica Acta 1830년 4 (2013):2981–2988.
  8. 8 I. Stewart et al. 가축, 야생 포유류 및 조류의 남조류 중독 – 개요. 실험 의학 및 생물학의 발전 619 (2008):613–637.

기부자

  • Nina Parker(Shenandoah University), Mark Schneegurt(Wichita State University), Anh-Hue Thi Tu(Georgia Southwestern State University), Philip Lister(Central New Mexico Community College), Brian M. Forster(Saint Joseph's University) 기여 작가. Openstax를 통한 원본 콘텐츠(CC BY 4.0, https://openstax.org/books/microbiology/pages/1-introduction에서 무료 액세스)


재생 가능한 자원에서 수소의 생물학적 생산

2.3 광발효

광합성 박테리아는 질소 분해 효소 시스템의 작용을 통해 수소를 생산하는 능력에 대해 오랫동안 연구되어 왔습니다. 보라색 박테리아의 광합성 장치는 간단하고 세포 내 막에 고정되어 있고 물을 분해할 만큼 강력하지 않은 하나의 광계(PS)만 있습니다[ 29 ]. 그러나 혐기성 조건에서 이 박테리아는 단순한 유기산이나 이황화수소를 전자 공여체로 사용할 수 있습니다. 유기 탄소 또는 H에서 해방된 전자2S는 많은 수의 전자 캐리어를 통해 펌핑됩니다. 전자 수송 중에 양성자는 막을 통해 펌핑되고 ​​양성자 구배가 발생하여 ATP 합성 효소에 의해 ATP를 생성하는 데 사용됩니다. ATP 형태의 여분의 에너지는 전자를 전자 수용체 페레독신(Fd)으로 더 운반하는 데 사용될 수 있습니다. 분자 질소가 존재하지 않을 때 페로독신에 있는 전자는 질소를 사용하여 양성자를 수소로 환원시킬 수 있습니다. 이 전체 과정은 앞에서 주어진 식(3)으로 표현될 수 있다.

일산화탄소는 다음과 같이 일부 광합성 박테리아에 의한 수성 가스 이동 반응을 통해 수소 생산에 사용될 수도 있습니다[ 30–32 ].

이 CO는 열로 가스화된 목재 칩에서 생성될 수 있습니다. 명백하게, CO-연결된 수소화효소는 실제 적용에 가장 적합하며, 산소 저항 효소가 확인되었습니다. 효소는 최대 96mmol H의 속도로 CO로부터 수소 생산을 매개합니다.2/(L·h) [ 10 ].


액세스 옵션

1년 동안 전체 저널 액세스 권한을 얻으십시오.

모든 가격은 NET 가격입니다.
VAT는 나중에 체크아웃 시 추가됩니다.
세금 계산은 체크아웃 시 완료됩니다.

ReadCube에서 시간 제한 또는 전체 기사 액세스 권한을 얻으십시오.

모든 가격은 NET 가격입니다.


시아노박테리아의 하향식 제어: 이론적 분석

현장 패턴과 실험 결과는 동물성 플랑크톤 방목이 대규모 식민지 시아노박테리아의 풍부함에 미치는 영향이 경우에 따라 크게 다를 수 있음을 시사합니다. 이 기사에서 우리는 시아노박테리아 사이의 경쟁을 설명하는 모델에 대한 광범위한 분석을 제시합니다. 진동 그룹과 녹조류에 의해 착취 물벼룩. 특히, 동물성 플랑크톤 어류에 의한 포식 및 영양소 농도 변화에 대한 모델의 반응을 연구합니다. 시아노박테리아의 영양가와 동물성 플랑크톤 방목의 선택성에 대한 다양한 가정에 대해 분석을 반복합니다. 물고기 포식 압력이 너무 높을 때 물벼룩 밀도는 무시할 만하고 두 주요 생산자 사이에는 경쟁적 배제가 있으며 다양한 영양소 수준에서 두 가지 대체 유인자가 있습니다. 하나는 남조류만 있고 다른 하나는 녹조류입니다. 어류의 포식 압력이 낮을 때 동물성 플랑크톤이 중요해지고 이들 동물의 방목이 충분히 선택적인 경우 제3의 유인물이 발생할 수 있습니다. 물벼룩, 남조류 및 조류가 공존합니다. 이 "혼합된" 어트랙터는 고정, 진동 또는 무질서할 수 있습니다. 영양 수준, 남조류의 영양가 및 동물성 플랑크톤의 선택성에 따라 남조류 우성은 물고기 포식 감소에 대한 반응으로 유도되거나 제거될 수 있습니다. 이것은 현장 연구 및 실험 결과의 혼란스러운 배열과 잘 일치합니다.


4.3.4: 남조류 - 생물학

a 화학과, 함부르크 대학교, 20146, 독일 함부르크
이메일: [email protected]

추상적 인

바나듐은 적어도 두 가지 측면에서 특별합니다. 한편으로는 사면체 음이온 바나데이트(V)는 인산염 음이온 바나데이트와 유사하므로 인산염에 의해 기능화되는 다양한 생리학적 기질과 상호작용할 수 있습니다. 반면에, 전이 금속 바나듐은 4면체 배위 이상으로 구를 쉽게 확장할 수 있으며 산화 상태 +V, +IV 그리고 +III 생리적 환경에서. 바나데이트와 인산염 사이의 유사성은 말톨레이트 및 피콜리네이트와 같은 담체 리간드를 갖는 바나듐 화합물의 항당뇨병 잠재력과 심혈관 및 신경 결함에서 바나듐의 매개를 설명할 수 있습니다. 더 복잡한 바나듐 배위 화합물의 다른 잠재적인 의약 응용, 예를 들어 기생 열대성 질병의 치료에서 또한 리간드 구체의 특정 특성에 뿌리를 둘 수 있습니다. 바나듐의 산화 상태 변화의 용이성은 원핵생물(박테리아 및 남조류)과 진핵생물(조류 및 진균)이 호흡 및 효소 기능에서 사용합니다. 거대 조류(해조류), 균류, 지의류 및 스트렙토마이세스 박테리아는 haloperoxidase를 사용할 수 있으므로 할로겐화물 X의 2-전자 산화를 가능하게 하는 효소가 있습니다. 루이스 산성 V에 의해 촉매되는 과산화물로 V 센터. 더 엑스 + 이렇게 형성된 종은 유기 기질을 산화적으로 할로겐화하는 데 사용될 수 있으며, 이는 대기의 화학 공정에도 영향을 미칩니다. 박테리아의 바나듐 의존성 질소화효소(아조토박터) 및 시아노박테리아(아나바에나) N 변환2 + H + NH에4 + + H2, 그러나 또한 CO 및 C와 같은 대체 기질을 수용합니다.2시간2. 자연에서 바나듐의 활용과 관련하여 해결해야 할 수수께끼 중 V의 축적은 III 일부 바다 물총새와 부채벌레뿐만 아니라 nonoxido V의 목적 IV 플라이 아가릭에 있는 화합물 아마바딘.


Psb29/Thf1의 구조 및 시아노박테리아의 광계 II 복구에 관여하는 FtsH 프로테아제 복합체와의 연관성

작물에서 광합성을 향상시키는 한 가지 전략은 빛에 의한 비가역적 손상에 대응하여 광계 II(PSII)를 복구하는 능력을 향상시키는 것입니다. 수리 중 광계2 소단위의 선택적 분해에서 틸라코이드가 포함된 FtsH 프로테아제 복합체의 중추적인 역할에도 불구하고 FtsH 발현 조절과 관련된 인자에 대해서는 알려진 바가 거의 없습니다. 여기에서 우리는 시아노박테리움을 사용하여 보여줍니다. 유착낭종 특. PCC 6803은 원래 His 태그가 붙은 광계 II 제제의 부성분으로 식별된 Psb29 소단위가 FtsH 복합체와 물리적으로 상호작용한다는 것입니다. 생체 내 광계 II 복구에 관여하는 FtsH2/FtsH3 이종 올리고머 복합체의 정상적인 축적에 필요합니다. 우리는 X선 결정학을 사용하여 Psb29의 Thermosynechococcus elongatus 나선 묶음과 확장된 C-말단 나선으로 구성된 독특한 접힘을 가지며 FtsH에 결합하는 것과 관련될 수 있는 고도로 보존된 영역을 포함합니다. THF1이라고 하는 Psb29 동족체와 FTSH2/FTSH5 복합체 사이의 Arabidopsis 엽록체에서도 유사한 상호작용이 일어날 가능성이 있습니다. FtsH 축적에서 Psb29/THF1의 직접적인 관련은 왜 THF1이 병원체 감염에 의해 유도된 식물의 과민 반응 동안 표적인지 설명하는 데 도움이 됩니다. THF1을 통한 FtsH 기능 및 광계 II 복구 주기를 하향 조절하면 활성 산소 종의 생성, 엽록체 기능 손실 및 세포 사멸에 기여할 것입니다.

이 기사는 '작물 식물의 광합성 향상: 개선 대상'이라는 주제의 주제 중 일부입니다.

1. 소개

과도한 빛에 노출된 식물은 만성 광억제라고 하는 손상된 광합성 활동으로 고통받습니다[1,2]. 손상의 주요 표적 중 하나는 틸라코이드 막 시스템에 내장된 산소 진화 광계 II(PSII) 복합체입니다. 이 복합체는 빛 에너지를 사용하여 물에서 전자를 추출하여 광합성 전자 수송 사슬에 공급하여 필요한 ATP와 NADPH를 생성합니다. CO2 고정 [3]. 광계 II의 비가역적 비활성화는 모든 광도에서 발생하지만[4,5] 손상된 단백질 소단위, 주로 D1 반응 중심 소단위를 새로 합성된 사본으로 교체하는 복구 주기의 작동을 통해 활성을 회복할 수 있습니다[1,6]. . 수리가 손상과 일치할 수 없는 경우에만 광계 II 활동의 순 손실이 있습니다. 결과적으로, 산화 손상에 취약한 복구 주기의 효율성을 개선하는 것은 빛 스트레스에 노출된 작물에서 광합성을 향상시키는 잠재적인 경로입니다.

광계2의 복구는 산소 광합성을 수행하는 모든 유기체에서 발생합니다[8,9]. 남조류와 엽록체에서 광계2의 구조에는 약간의 차이가 있지만[10] 광계2 조립 및 복구에 관여하는 많은 보조 인자와 프로테아제가 보존되어 있어 남조류를 분자 세부 사항을 연구하는 데 매우 유용한 모델로 만듭니다[11,12]. 광계2 생물발생 [13].

복구 중 손상된 D1을 분해하는 주요 경로는 시아노박테리아[14,15]와 엽록체[16-18] 모두에서 ATP 의존성 메탈로프로테아제의 FtsH 계열의 특정 구성원에 의한 단백질 분해를 포함합니다. 남세균의 경우 유착낭종 특. PCC 6803(이하 유착낭종 6803), 전자 현미경은 분리된 FtsH 복합체가 6량체이고 교대 FtsH2 및 FtsH3 소단위로 구성되어 있음을 밝혀냈으며[19], 계통발생학적 분석에 따라 각각 유형 B 및 유형 A FtsH 동형으로 분류되었습니다[20,21 ]. 구조적 확인이 현재 부족하지만, A형과 B형 서브유닛으로 구성된 유사한 6량체 헤테로-복합체는 엽록체의 광계2 복구에 관여할 가능성이 높습니다[18,21]. FtsH2에 상동성) 및 FTSH5(FtsH3에 상동성인 유형 A 소단위) [21]. Arabidopsis FTSH2 및 FTSH5 소단위체는 노란색 잡색 표현형 때문에 각각 VAR2 및 VAR1이라고도 합니다. var2 그리고 var1 널 돌연변이 [21]. 엽록체 FtsH 프로테아제는 Arabidopsis에서 핵으로 암호화되어 있으므로 유전자 산물은 대문자로, 돌연변이체는 소문자 및 이탤릭체로 작성됩니다.

가벼운 스트레스에 대한 반응으로 FtsH 복합체의 발현이 어떻게 조절되는지는 불분명합니다. 잡색의 최근 연구 thf1 (틸라코이드 형성 1) Arabidopsis의 돌연변이 [22]는 THF1 단백질이 FTSH2/VAR2 및 FTSH5/VAR1의 정상적인 축적에 필요하며 이 효과는 전사 후 발생한다고 밝혔습니다[23,24]. Psb29 또는 Thf1로 명명된 남세균의 THF1 상동체는 원래 히스태프의 분리된 His 태그가 붙은 광계2 제제의 준화학량론적 성분으로 확인되었습니다. 유착낭종 6803 [25] 및 광계2 유지에 대한 역할은 광계에서 가벼운 스트레스에 대한 광계2 활성의 향상된 민감성을 기반으로 제안되었습니다. 유착낭종 6803 PSB29 null 돌연변이가 있지만 FtsH에 대한 특정 효과는 조사되지 않았습니다[26]. FtsH 수준의 감소는 최근에 보고되었습니다. PSB29 시아노박테리움의 null 돌연변이 시네코코커스 특. PCC 7942, 그러나 개별 FtsH 소단위의 발현에 대한 변화는 조사되지 않았다[27]. 또한 Psb29/Thf1이 광계 I과 상호 작용한다고 제안되었습니다[27].

여기서 우리는 Psb29가 유착낭종 6803은 Arabidopsis의 THF1과 같이 광계2 복구에 관여하는 FtsH 이종복합체의 정상적인 축적에 중요합니다. 또한, 친화성 정제 데이터는 Psb29가 FtsH 복합체와 물리적으로 상호작용함을 시사합니다 생체 내. Psb29에 대한 추가 통찰력을 얻기 위해 다음으로 인코딩된 Psb29의 결정 구조를 결정했습니다. 써모시네코쿠스 엘롱가투스, 광계2 조립 및 수리의 구조적 측면을 연구하는 데 널리 사용되는 호열성 남세균[28,29]. Psb29는 FtsH와 같은 특정 단백질/단백질 상호작용에 중요할 수 있는 분자의 한 면에 고도로 보존된 표면을 포함합니다. Psb29의 두드러진 특징은 구형 단백질 도메인에서 확장되는 C-말단에 긴 알파 나선이 있다는 것입니다.

2. 재료 및 방법

(a) 시아노박테리아 균주 및 성장 조건

모든 돌연변이는 포도당 내성 WT-P 균주에서 구성되었습니다. 유착낭종 특. PCC 6803 [30] 및 [31]에 설명된 대로 BG11 배지를 사용하여 성장했습니다. 혼합영양 배양의 경우, 포도당은 일반적으로 5mM으로 첨가되었습니다. 단백질 및 RNA 분석의 경우 50–100ml의 액체 배양액 유착낭종 6803은 적당한 광 조건(40 µmol 광자 m -2 s -1 ) 하에 29°C에서 250 ml 원뿔형 플라스크의 BG11 배지에 있는 오비탈 쉐이커에서 성장했습니다. 단백질 복합체의 정제를 위해, FtsH2-FLAG 균주를 2 l 원뿔형 플라스크를 사용하여 500 ml의 배지에서 상술한 바와 같이 성장시켰다. Psb29-FLAG 단백질 복합체의 정제를 위해 Psb29-FLAG 균주 4리터를 1mM 포도당이 보충된 BG11 배지의 10리터 플라스크에서 성장시키고 자기 교반기로 교반하고 공기로 버블링했습니다. 두 경우 모두, 표면 조도는 플라스크의 더 긴 경로 길이를 보상하기 위해 빛의 100 µmol 광자 m -2 s -1 로 증가되었습니다. 반점 성장 시험을 위해 혼합영양 배양액 2.5㎕와 10 2 , 10 3 및 10 4 연속 희석액을 BG11 한천 플레이트에 점적하고 7일 동안 성장시켰다.

(b) 시아노박테리아 돌연변이체의 구축

중단을 위한 변환 벡터 PSB29 유전자 유착낭종 6803(시아노염기 명칭 sll1414) 두 단계로 구성되었습니다. 먼저 플랭킹 시퀀싱 sll1414, 445 bp의 상류와 하류 BP 555, PCR 프라이머 세트 sll1414-1F (AGTTTCTCGTTCTGCCGCCTCAGCTCTT) 및 sll1414-2R (AATGGGGCCTCATAGTGGGGCATGGATTGAAGATATCAGGGCCGATTACAAAGGGGGGGATAGT)로 증폭하고, sll1414-3F (ACTATCCCCCCCTTTGTAATCGGCCCTGATATCTTCAATCCATGCCCCACTATGAGGCCCCATT) 및 sll1414-4R (ATTAACTCCCCATCCACTTCCACTTCGATGAT). 이어서, 생성된 PCR 생성물을 프라이머 세트 sll1414-1F 및 sll1414-4R을 갖는 중첩 연장 PCR을 위한 DNA 주형으로서 혼합하였다. 대신 EcoRV 제한 부위를 포함하는 융합된 PCR 단편 sll1414 그런 다음 ORF를 pGEM-T Easy 벡터에 클로닝했습니다. 두 번째 단계에서는 클로람페니콜 내성을 부여하는 DNA 카세트를 EcoRV 부위에 삽입했습니다. blunt-end ligation의 특성으로 인해 두 개의 형질전환 벡터가 선택되었습니다: pSll1414camA는 chloramphenicol marker가 다음과 같은 방향으로 통합되어 있습니다. sll1414, 반면 pSll1414camB는 반대 방향에 마커가 있습니다. 두 플라스미드는 포도당 내성 WT-P 균주를 형질전환하는 데 사용되었습니다. 유착낭종 6803, 균주 ΔPsb29camA 및 ΔPsb29camB를 생성합니다.

Psb29 및 FtsH2의 C-말단 3xFLAG 태그 파생물을 발현하기 위한 변환 벡터 psbA2 pPD-CFLAG의 NdeI 및 NheI 부위에 PCR 단편을 클로닝하여 유전자좌를 생성하였다[32]. 의 코딩 시퀀스 PSB29 (sll1414) 프라이머 쌍 CF-Psb29-F(TTTTTTCATAGACTAAAATTCGCACTGTTTCTGACGCCAA) 및 CF-Psb29-R(TTTTTTGCTAGCGCTTTCGGAACTCTCCGCTGTGGTT) 및 ftsH2 (slr0228) 프라이머 세트 CF-FtsH2-F(TTTTTTCATATGAAATTTTCCTGG.AGAACTGCCCTACTT) 및 CF-FtsH2-R(TTTTTTGCTAGCTAGTTGGGGAATTAACTGTTCCTTGACGGGA)으로 증폭되었습니다. NS 유착낭종 6803 돌연변이 ΔPsb29camA를 배경 균주로 사용하여 Psb29-FLAG/ΔPsb29 및 삽입 돌연변이를 생성했습니다. slr0228::cm R [15] FtsH2-FLAG/ΔFtsH2를 생성하도록 형질전환되었다.

(c) 막의 준비, FLAG-태그 면역친화성 정제 및 단백질 분석

Mini-Beadbeater-16(BioSpec) 및 anti-FLAG 풀다운을 사용하여 세포를 파괴하여 막 준비를 [33]에 설명된 대로 수행했습니다. 세포 및 다양한 제제의 엽록소 농도는 메탄올로 추출하고 666 및 720 nm에서 흡광도를 측정하여 측정했습니다[34]. 단백질 복합체의 분석은 각각 7M 요소를 함유하는 4~14% 천연 및 12~20% SDS 겔에서 2차원 투명 천연/SDS 폴리아크릴아미드 겔 전기영동(2D-CN/SDS PAGE)을 사용하여 수행되었습니다[33]. 젤을 Coomassie Blue로 염색하고 시각화된 밴드를 질량 분석(MS) 분석 또는 형광 염료 SYPRO Orange로 염색한 다음 면역 검출을 위해 PVDF 멤브레인에 얼룩을 묻혔습니다. 단백질은 FtsH1, FtsH2, FtsH3 및 전체 FtsH(FtsHg)[19], Phb1 및 Phb3[35] 및 Psb29에 대해 특이적인 항체를 사용하여 검출되었습니다. 유착낭종 키홀 림펫 헤모시아닌(Clonestar, Brno, Czech Republic)에 접합된 Psb29.

(d) 단백질의 질량 분광학적 식별

겔에서 절단된 단백질 밴드의 MS 분석은 [36]에 설명된 대로 ESI Q-ToF Premier 질량 분석기(Waters)에 연결된 NanoAcquity UPLC(Waters) 온라인에서 수행되었습니다.

(e) 결정 ftsH2 그리고 ftsH3 성적표 수준

의 결정 ftsH2 그리고 ftsH3 정량적 PCR에 의한 전사체 수준은 특정 프라이머를 사용하여 [31]에 설명된 대로 수행되었습니다. ftsH2 그리고 ftsH3 및 전사자 역전사효소(Roche). NS rnpB 리보뉴클레아제 P의 B 서브유닛을 코딩하는 유전자를 참조로 사용하고 3개의 독립적인 배양물을 사용하여 3중으로 분석을 수행하였다.

(f) Psb29 및 구조 용액의 발현

Psb29의 코딩 서열 T. elongatus (Cyanobase 명칭: Tlr1134)를 증폭시킨 후 변형된 pRSETA 발현 벡터의 BamHI 및 XhoI 부위에 클로닝하였다[28]. PSB29 프라이머 세트 Tlr1134-F(GGATCCGTGCAAAATCCTCGAACTGTCTCTGATACCAAACG) 및 Tlr1134-R(CTCGAGTCAAGCGGGTGCATCGGAGCTGGCAT) 사용. 생성된 벡터 pRSETAPsb29는 N-말단에서 6xHis 태그에 이어 트롬빈 절단 부위와 Psb29로 구성된 재조합 단백질을 인코딩합니다. NS 대장균 균주 KRX를 재조합 Psb29 발현에 사용하였다. 형질전환된 세포에서 Psb29 발현은 OD에서 유도되었다730 1 g l -1 람노스로 0.8의 농도를 유지하고 세포를 18℃에서 밤새 성장시켰다. 세포를 용해 완충액(50mM Tris-HCl pH 7.9, 500mM NaCl, 1mM MgCl)에서 초음파 처리하여 용해시켰다.2). 일부 준비에서 용해 완충액은 완전한 프로테아제 억제제 칵테일 정제 - EDTA(Roche, UK)로 보충되었습니다. 상층액을 Ni-IDA 수지(Generon, UK)와 혼합하였다. 세척 완충액(20mM Tris-HCl pH 7.9, 500mM NaCl, 60mM 이미다졸)으로 3회 세척하여 비특이적으로 결합된 단백질을 제거하고, 용출 완충액(20mM Tris-HCl pH 7.9, 500mM NaCl)으로 Psb29를 용출시켰다. , 1M 이미다졸). 단백질을 20mM Tris-HCl pH 7.9, 500mM NaCl에서 약 10mg ml -1로 농축하고 결정화 시험에 사용했습니다. 농축된 샘플은 Mosquito ® 로봇(TTP LabTech, UK)을 사용하여 액적 증기 확산 결정화 스크린에 놓였습니다.

프로테아제 억제제 존재하의 제제의 경우, 수득된 유일한 결정은 P6의 침상 형태였다.322로 매우 약하게 회절되었다. protease inhibitor를 생략하면 3가지 형태의 결정체를 쉽게 얻을 수 있다. 이 중 2개는 P2에 있었습니다.1 (지정 A-P21 및 B-P21) 및 I222의 세 번째. 구조는 A-P2를 사용하여 단일 파장 변칙 분산(SAD)에 의해 해결되었습니다.1 결정 형태, 1mM 사요오도머쿠산이칼륨(Jena Bioscience)에 밤새 담가 놓았습니다. P6322 form을 1mM 4-(Chloromercuri)benzensulfonic acid sodium salt(Jena Bioscience)에 밤새 침지시켰으나 상 측정에는 사용하지 않았다. 결정을 30% 글리세롤이 첨가된 모액에서 동결 보호하고 루프에서 액체 질소로 플래시 냉각시켰다. 다이아몬드 광원에서 회절 데이터를 수집하고 XDS[38]와 함께 xia2[37]를 사용하여 처리했습니다. 데이터 수집 및 정제 정보는 표 1을 참조하십시오. A-P2의 중원자 부위1 autoSHARP[39] 파이프라인을 사용하여 구조가 단계적으로 발견되었습니다. 초기 모델은 Buccaneer[40]로 구축되었고 REFMAC[41]로 개선되었습니다. B-P21,I222 및 P63A-P2를 사용하여 Phaser[42]로 분자 교체하여 22개의 결정 형태를 해결했습니다.1 구조를 모델로 합니다. 이러한 구조는 REFMAC 또는 phenix.refine으로 개선되었습니다[43]. 구조는 MolProbity[44]를 사용하여 검증되었습니다.

표 1. Psb29 구조에 대한 데이터 수집 및 개선 통계. 괄호 안의 값은 고해상도 셸을 나타냅니다. DLS, 다이아몬드 광원.

(g) 생물정보학

211개의 Psb29 서열은 유착낭종 6803 (sll1414 유전자 제품) UniProt KnowledgeBase Reference proteomes (http://www.uniprot.org). 컷오프 임계값은 결과 히트를 수동으로 조사한 후 경험적으로 1x10 -4 로 설정되었습니다. 103개 기록은 남조류, 84개 식물, 11개 녹조류, 12개 홍조류, 1개 녹조류 감염 바이러스 클로렐라 특. 균주 NC64A. 그런 다음 MAFFT 버전 7 프로그램을 사용하여 'G-INS-I' 설정이 적용된 211개의 시퀀스를 정렬했습니다[45]. 정렬 내의 간격은 'gappyout' 방법을 사용하여 trimAl에 의해 트리밍된 다음 [46] 정렬이 최대 가능성 기반 계통 발생 추론인 PhyML에 적용되었습니다. ETE3 툴킷[47]은 위의 프로세스를 자동화하는 데 사용되었습니다. PhyML 설정은 '+G+I+F, 4개의 클래스 및 aLRT 분기 지원, 기본 모델 JTT/GTR'[48]이었습니다. 뿌리가 없는 최종 트리는 iTOL[49]로 정리 및 미화되었습니다. 103개의 시아노박테리아 및 84개의 식물 Psb29 서열의 하위 집합이 계통 발생에 따라 클러스터링되었습니다. 보존 분석에 사용된 잘린 정렬은 MatGAT[50]을 사용하여 동일성 및 유사성 계산을 받았습니다. 진화적 보존은 ConSurf 2016 서버를 사용하여 분석되었습니다[51]. 위의 MAFFT 정렬은 애기장대 ChloroP 1.1 Server[52]에서 예측한 THF1도 제거되었습니다.

3. 결과

(a) Psb29는 FtsH2 및 FtsH3의 정상적인 발현에 필요합니다. 유착낭종 6803

Psb29가 FtsH의 발현에 역할을 하는지 테스트하기 위해 유착낭종 6803, 우리는 세포에서 분리된 막의 면역 블로팅 분석을 수행했습니다. PSB29 null 돌연변이, ΔPsb29camA, 여기서 PSB29 유전자는 클로람페니콜 내성 카세트로 대체되었습니다(전자 보충 자료, 그림 S1NS,NS). photoautotrophic 또는 mixotrophic 조건에서 후기 지수 단계로 성장한 문화를 분석했습니다. 에 의해 암호화된 4개의 FtsH 단백질 각각에 특이적인 항체 유착낭종 6803은 FtsH2 및 FtsH3의 수준이 WT 대조군과 비교하여 돌연변이체에서 실질적으로 감소한 것으로 나타났으며, 이는 FtsH2/FtsH3 이종-복합체의 축적에 대한 특정 효과와 일치하는 반면, FtsH1 및 FtsH4에 대한 영향은 더 적었습니다(그림 1NS). 로도 비슷한 결과를 얻었다. PSB29 반대 방향으로 삽입된 클로람페니콜 내성 카세트를 포함하는 null 돌연변이 ΔPsb29camB(전자 보충 자료, 그림 S1교류). 역전사 PCR은 다음을 확인했습니다. ftsh2 그리고 ftsH3 ΔPsb29camA에서 여전히 전사되어 FtsH2 및 FtsH3의 발현에 대한 Psb29의 효과는 전사 후에 발생했습니다(그림 1NS). 2~5배 증가 ftsH2 그리고 ftsH3 ΔPsb29camA의 전사체는 발현을 증가시키는 보상 메커니즘을 반영할 수 있습니다. 중요하게도, 면역 블로팅 실험은 FtsH2 및 FtsH3 발현이 감소했지만 Psb29가 없을 때 완전히 차단되지는 않았다는 것을 보여주었습니다(전자 보충 재료, 그림 S1).

그림 1. (NS) OD가 될 때까지 포도당의 존재(+Glc) 또는 부재(-Glc)에서 성장한 WT 및 ΔPsb29camA의 FtsH 소단위체의 면역화학적 분석730 0.6–0.8. 단백질 염색(Sypro 염색)에 의해 평가된 단백질 로딩. (NS) 상대 성적표 수준 ftsH2 그리고 ftsH3 RT-PCR에 의해 결정된 WT 및 ΔPsb29camA에서.

(b) Psb29는 FtsH 복합체와 상호 작용합니다.

Psb29가 FtsH와 상호 작용하는지 테스트하기 위해 두 가지 균주를 생성했습니다. 유착낭종 6803은 3XFLAG 태그를 추가하여 C-말단에 태그가 지정된 Psb29 또는 FtsH2를 표현합니다. 의 제어 하에 태그된 단백질의 발현 psbA2 관련 발기인 ftsH2 또는 PSB29 null 돌연변이는 높은 조도에서 광독립영양 성장을 복원하여 태그가 지정된 단백질이 여전히 기능적임을 나타냅니다(전자 보충 재료, 그림 S2). 항-FLAG 항체를 사용하여 세제-가용화된 막으로부터 Psb29-FLAG의 면역친화성 정제, 이어서 2D 겔 전기영동(첫 번째 차원에서는 투명하고 두 번째 차원에서는 변성) 및 단백질 염색, 면역블롯팅 및 질량 분석에 의한 단백질 검출은 다음을 밝혀냈습니다. FtsH2, FtsH3 및 FtsH1을 포함하는 큰 복합체의 존재(그림 2NS), 우리는 이전 연구를 기반으로 FtsH2/FtsH3 및 FtsH1/FtsH3 이종복합체에 할당합니다[19]. 또한 FtsH1, FtsH2 및 FtsH3에서 파생된 단편이 미조립 단백질로 이동했으며 Band 7 슈퍼패밀리의 두 구성원인 FtsH2/FtsH3 제제[19] 및 Phb3[35]에서 이전에 검출된 프로히비틴(prohibitin)이 검출되었습니다. Psb29-FLAG는 기본 겔에서 FtsH와 함께 이동하지 않아 전기 영동 동안 분리가 나타납니다. FtsH2-FLAG 균주를 사용한 상호 면역친화성 정제는 FtsH2 및 FtsH3와 Psb29의 공동 정제를 확인했습니다(그림 2NS). 전반적으로 이러한 데이터는 Psb29와 FtsH2/FtsH3 복합체의 직접적인 상호작용을 뒷받침합니다.

그림 2. (NS) FLAG 태그가 지정된 Psb29의 분리 및 2D 겔 전기영동 후 Coomassie Brilliant Blue(CBB) 염색 및 질량 분석법(왼쪽 패널) 또는 FtsH2로 시작하여 표시된 순서대로 항체를 사용한 순차적 면역화학 검출에 의한 공동 정제 단백질 식별(오른쪽 패널). 전역 FtsH 항체는 모든 FtsH 동형체(FtsHg)를 인식하는 반면 다른 FtsH 항체는 각 소단위에 대해 특이적입니다. (NS) Sypro 오렌지(SYPRO 염색)로 젤을 염색한 후 FLAG 태그 FtsH2의 분리 및 질량 분석에 의한 단백질 검출.

(c) Psb29의 결정 구조 T. elongatus

Psb29에 대한 구조적 정보를 얻기 위해 우리는 cyanobacterium에 의해 인코딩된 Psb29를 과발현했습니다. T. elongatus N-말단 His-tagged 단백질로서 대장균 Ni-affinity 크로마토그래피에 의해 단백질을 분리하였다. 매달린 방울 증기 확산에 의해 4개의 결정 형태를 얻었다. X선 회절 데이터는 3.6 Å에서 1.4 Å의 분해능에서 수집되었고 Psb29의 구조는 중원자 SAD에 의해 결정되었습니다(표 1). Psb29의 예측된 222개 잔기 중 4번부터 206번까지의 잔기로 구성된 가장 완전한 구조는 P6에서 얻었습니다.3비대칭 단위에 Psb29의 7개 사본을 포함하는 22개의 바늘 모양의 결정으로, 결정에서 단백질의 연속적인 원통형 껍질을 형성하고, 단백질의 C-말단이 나선을 형성하는 소형 단백질 접힘에서 원통형의 중간까지 연장되는 나선을 형성합니다. 단백질 껍질(전자보충재, 그림 S3NS). 각 Psb29 소단위는 9개의 알파 나선으로 구성됩니다(그림 3). PDBeFOLD[53]를 사용한 검색은 70% 이상의 유사성을 가진 알려진 구조를 발견하지 못했으며 이는 특정 접힘이 참신함을 나타냅니다.

그림 3. 다음으로 인코딩된 Psb29(PDB: 5MLF)의 구조 T. elongatus 9개의 알파 나선의 측면 및 평면도와 만화 표현을 보여줍니다.

다른 결정 형태의 Psb29는 C-말단에서 단백질 분해로 절단되었다. B-P2에서1 결정 형태, 잔기 Ala189의 새로운 카르복시 말단은 전자 밀도에서 명확하게 볼 수 있습니다(전자 보충 재료, 그림 S3NS). C-말단 나선의 단백질 분해 절단은 P6에서 관찰된 C-말단 나선을 수용하기 위해 격자에 공간이 충분하지 않기 때문에 더 조밀한 고해상도 결정 격자를 형성할 수 있습니다.322 크리스탈 형태. I222 결정 형태는 N 말단에서 잔기 Ile22까지 N 말단 나선의 도메인 스와핑을 보여주며, 도메인 스와핑된 이량체를 생성합니다(전자 보충 재료, 그림 S3). Given that the domain-swap is not observed in the other crystal forms, this is probably a crystallization artefact.

(d) Comparison of Psb29/THF1 sequences

Bioinformatic analyses revealed that Psb29 and its eukaryotic homologue THF1 are found solely in oxygenic photosynthetic organisms (electronic supplementary material, figure S4). One exception is a virus infecting the green alga 클로렐라 특. strain NC64A that possesses a Psb29-encoding gene closely related to green algal Psb29 sequences (electronic supplementary material, figure S4). In the proteome database interrogated on 11th November 2016, 103 out of 106 cyanobacteria were found to encode Psb29 homologues. The genome sequences of the three remaining cyanobacteria, Limnoraphis robusta CS-951, Leptolyngbya valderiana BDU 20041, and Cyanobium 특. PCC 7001 (시네코코커스 특. PCC 7001) are still incomplete and so still yet might encode Psb29.

Overall Psb29 from T. elongatus shows a mean sequence similarity of 59.2% with the 102 cyanobacterial Psb29 sequences examined and 53.7% with the 84 plant THF1 sequences. Six residues are totally conserved in cyanobacterial and plant Psb29/THF1 sequences (electronic supplementary material, figure S5): based on the structure described here, F14, V35, L39, G55 and G138 (T. elongatus numbering) appear important for the packing of alpha helices and R133 at the beginning of helix 7 is within H-bonding distance of E36 in the middle of helix 2 (electronic supplementary material, figure S4). These sequence identities would suggest a high degree of conservation of tertiary structure between Psb29 and THF1 in this region of the molecule. A ConSurf analysis in which all Psb29/THF1 sequences were fitted into the T. elongatus structure revealed high sequence conservation on one face of the molecule, which would indicate an important role for this region in protein function (figure 4). There are several conserved residues in this region that might play a role in binding interacting partners such as FtsH (figure 5).

Figure 4. Highly conserved residues in T. elongatus Psb29. A ConSurf analysis was performed based on the alignment of 211 Psb29/THF1 sequences from oxygenic phototrophs. The front and back views highlight the conserved and variable regions of Psb29 using the following colouring scheme: purple, 9 = maximal conservation white, 5 = average conservation green, 1 = maximal variability.

Figure 5. Close-up view of the conserved residues of Psb29/THF1 identified by ConSurf analysis. The most conserved residues that are not buried within the Psb29 structure are shown in stick form, with red indicating oxygen atoms and blue nitrogen atoms. Intra-protein side-chain polar contacts are shown as yellow dashed lines. Some residues are colour-coded to indicate possible type of interaction. Red labels indicate potential hydrogen bonding/charged residues that might stabilize protein/protein interactions yellow labels indicate residues possibly involved in both stabilizing the structure and interacting with proteins light blue labels indicate potential hydrophobic contact sites.

The alignment of Psb29/THF1 sequences revealed a variety of small insertions and deletions. In the case of plant THF1, these insertion/deletion events correspond to T. elongatus residues 121–122 and 151–154, which lie in loop regions connecting alpha helices 6–7 and 7–8, respectively (electronic supplementary material, figure S5), in the more divergent region of Psb29. The C-terminal end of the protein is also poorly conserved (electronic supplementary material, figures S5 and S6).

4. 토론

Previous work in Arabidopsis has shown that the absence of THF1 leads to a 40–80% decrease in the amount of the type A and type B FTSH subunits involved in PSII repair as judged by immunoblotting [23]. We show here that loss of Psb29 has a similar effect in cyanobacteria, as levels of the FtsH2 and FtsH3 subunits that form the FtsH heterocomplex involved in PSII repair in 유착낭종 6803 are likewise reduced in psb29 null mutants (figure 1 electronic supplementary material, figure S1). These data suggest a conserved role for Psb29/THF1 in fine-tuning the expression of thylakoid FtsH heterocomplexes.

Importantly, we have provided evidence that Psb29 interacts directly with FtsH2/FtsH3 complexes (figure 2). Thus we suggest that Psb29/THF1 plays a direct role in the accumulation of FtsH heterocomplexes. Based on the co-purification of FtsH1 with Psb29-FLAG (figure 2NS), it is possible that Psb29 is also involved in the accumulation of FtsH1/FtsH3 heterocomplexes [19]. However, levels of FtsH1 were much less affected than FtsH2 and FtsH3 in the psb29 null mutant under the conditions examined (figure 1).

Recent work, based on the analysis of cross-linked membrane protein complexes by sucrose density gradient centrifugation, has concluded that Psb29 in the cyanobacterium 시네코코커스 특. PCC 7942 binds to PSI complexes [27]. However, pull-down experiments were not done to confirm cross-linking between Psb29 and PSI. In light of our data, we suggest that further work is needed to exclude the possibility that Psb29 is actually cross-linked to FtsH complexes, which then co-sediment with PSI. Reduced expression of PSI was also reported in a psb29 null mutant [27] but this might be related to effects on expression of FtsH2 rather than a direct effect of Psb29 [54].

We have also presented the first structural information on Psb29. The first 3 and last 16 residues could not be identified in the most complete crystal structure, possibly because of structural flexibility or because of some proteolytic degradation. The fitting of cyanobacterial and plant Psb29/THF1 proteins into the T. elongatus crystal structure using ConSurf has allowed us to identify a highly conserved surface on Psb29 that might be involved in protein/protein interactions, such as with FtsH (figures 4 and 5). Recent work has indicated that residues 223–295 of THF1 of Nicotiana benthamiana, encompassing part of helix 8, all of helix 9 and most of the C-terminal tail, is a target for a sub-group of nucleotide-binding leucine-rich-repeat (NB-LRR) proteins involved in plant immunity [55]. Thus some of the observed sequence variation between Psb29 and THF1 might reflect changes in THF1 function since the divergence of plants and cyanobacteria.

PSII repair is one of several photoprotective mechanisms used by plants [2]. Despite its physiological importance, little work has been directed at enhancing PSII repair in crop plants, either in terms of robustness or speed of response. In the case of plants, damaged PSII complexes must migrate from the appressed membranes in the grana to the margins to be repaired [56]. This means that prompt degradation of damaged D1 might become a bottleneck in the repair process and that enhancing the expression of FTSH proteases, or DEG proteases that act as a second-line of defence [17], might delay or prevent chronic photoinhibition. Our work now identifies Psb29/THF1 as an additional target for manipulation.

Work in cyanobacteria has highlighted D1 synthesis as a weak link in PSII repair due to reactive oxygen species (ROS)-mediated oxidation of elongation factor EF-G required for protein translation [57]. Attempts to improve protein synthesis by mutating the two Cys residues of EF-G sensitive to oxidative damage has had limited success [58]. Instead a more promising approach is the over-expression of enzymes to detoxify ROS [59]. Prompt replacement of D1 during repair might also be helped by increasing the pool of unassembled D1 in the membrane that could be tapped into to replace damaged D1. One approach might be to over-express the higher plant homologues of Ycf48 and the Ycf39/Hlip complex, which have been shown to stabilize unassembled D1 in cyanobacteria [60,61].

Although upregulating FtsH activity and the PSII repair cycle would seem beneficial for plant growth, there appear to be situations where plants deliberately downregulate chloroplast FtsH activity, which is known to lead to the enhanced production of ROS even under non-photoinhibitory conditions [62]. The source of ROS is not clear but they could be produced by defective PSII complexes that have not been promptly repaired. One dramatic example is the hypersensitive response (HR), which is induced to kill plant cells infected by pathogens so as to limit the zone of infection [63]. Although chloroplast FtsH had previously been implicated in HR [64], the mechanism has been unclear. Recent evidence has suggested a role for THF1 in the signal transduction pathway [55,65]. Our data would suggest that loss of THF1 in the chloroplast plays a direct role in the decrease of FtsH activity, either by destabilizing FtsH complexes, as observed in the Arabidopsis thf1 null mutant [23] and/or by impairing assembly. Evidence from both cyanobacteria [66] and 클라미도모나스 라인하르트티 [67] suggests that upregulating synthesis of FtsH is important for acclimation to higher light intensities as well as possibly replacing damaged FtsH.


내용물

John Martin, director of the Moss Landing Marine Laboratories, hypothesized that the low levels of phytoplankton in these regions are due to a lack of iron. In 1989 he tested this hypothesis (known as the Iron Hypothesis) by an experiment using samples of clean water from Antarctica. [5] Iron was added to some of these samples. After several days the phytoplankton in the samples with iron fertilization grew much more than in the untreated samples. This led Martin to speculate that increased iron concentrations in the oceans could partly explain past ice ages. [6]

IRONEX I Edit

This experiment was followed by a larger field experiment (IRONEX I) where 445 kg of iron was added to a patch of ocean near the Galápagos Islands. The levels of phytoplankton increased three times in the experimental area. [7] The success of this experiment and others led to proposals to use this technique to remove carbon dioxide from the atmosphere. [8]

EisenEx Edit

In 2000 and 2004, iron sulfate was discharged from the EisenEx. 10 to 20 percent of the resulting algal bloom died and sank to the sea floor.

Commercial projects Edit

Planktos was a US company that abandoned its plans to conduct 6 iron fertilization cruises from 2007 to 2009, each of which would have dissolved up to 100 tons of iron over a 10,000 km 2 area of ocean. Their ship Weatherbird II was refused entry to the port of Las Palmas in the Canary Islands where it was to take on provisions and scientific equipment. [9]

In 2007 commercial companies such as Climos and GreenSea Ventures and the Australian-based Ocean Nourishment Corporation, planned to engage in fertilization projects. These companies invited green co-sponsors to finance their activities in return for provision of carbon credits to offset investors' CO2 배출. [10]

LOHAFEX Edit

LOHAFEX was an experiment initiated by the German Federal Ministry of Research and carried out by the German Alfred Wegener Institute (AWI) in 2009 to study fertilization in the South Atlantic. India was also involved. [11]

As part of the experiment, the German research vessel Polarstern deposited 6 tons of ferrous sulfate in an area of 300 square kilometers. It was expected that the material would distribute through the upper 15 metres (49 ft) of water and trigger an algal bloom. A significant part of the carbon dioxide dissolved in sea water would then be bound by the emerging bloom and sink to the ocean floor.

The Federal Environment Ministry called for the experiment to halt, partly because environmentalists predicted damage to marine plants. Others predicted long-term effects that would not be detectable during short-term observation [12] [ unreliable source? ] or that this would encourage large-scale ecosystem manipulation. [13] [ unreliable source? ] [14]

2012 Edit

A 2012 study deposited iron fertilizer in an eddy near Antarctica. The resulting algal bloom sent a significant amount of carbon into the deep ocean, where it was expected to remain for centuries to millennia. The eddy was chosen because it offered a largely self-contained test system. [15]

As of day 24, nutrients, including nitrogen, phosphorus and silicic acid that diatoms use to construct their shells, declined. Dissolved inorganic carbon concentrations were reduced below equilibrium with atmospheric CO
2 . In surface water, particulate organic matter (algal remains) including silica and chlorophyll increased. [15]

After day 24, however, the particulate matter fell to between 100 metres (330 ft) to the ocean floor. Each iron atom converted at least 13,000 carbon atoms into algae. At least half of the organic matter sank below, 1,000 metres (3,300 ft). [15]

Haida Gwaii project Edit

In July 2012, the Haida Salmon Restoration Corporation dispersed 100 short tons (91 t) of iron sulphate dust into the Pacific Ocean several hundred miles west of the islands of Haida Gwaii. The Old Massett Village Council financed the action as a salmon enhancement project with $2.5 million in village funds. [16] The concept was that the formerly iron-deficient waters would produce more phytoplankton that would in turn serve as a "pasture" to feed salmon. Then-CEO Russ George hoped to sell carbon offsets to recover the costs. The project was accompanied by charges of unscientific procedures and recklessness. George contended that 100 tons was negligible compared to what naturally enters the ocean. [17]

Some environmentalists called the dumping a "blatant violation" of two international moratoria. [16] [18] George said that the Old Massett Village Council and its lawyers approved the effort and at least seven Canadian agencies were aware of it. [17]

According to George, the 2013 salmon runs increased from 50 million to 226 million fish. [19] However, many experts contend that changes in fishery stocks since 2012 cannot necessarily be attributed to the 2012 iron fertilization many factors contribute to predictive models, and most data from the experiment are considered to be of questionable scientific value. [20]

On 15 July 2014, the data gathered during the project were made publicly available under the ODbL license. [21]

International reaction Edit

In 2007 Working Group III of the United Nations Intergovernmental Panel on Climate Change examined ocean fertilization methods in its fourth assessment report and noted that the field-study estimates of the amount of carbon removed per ton of iron was probably over-estimated and that potential adverse effects had not been fully studied. [22]

In June 2007 the London Dumping Convention issued a statement of concern noting 'the potential for large scale ocean iron fertilization to have negative impacts on the marine environment and human health',. [23] but did not define 'large scale'. It is believed that the definition would include operations. [ 인용 필요 ]

In 2008, the London Convention/London Protocol noted in resolution LC-LP.1 that knowledge on the effectiveness and potential environmental impacts of ocean fertilization was insufficient to justify activities other than research. This non-binding resolution stated that fertilization, other than research, "should be considered as contrary to the aims of the Convention and Protocol and do not currently qualify for any exemption from the definition of dumping". [24]

In May 2008, at the Convention on Biological Diversity, 191 nations called for a ban on ocean fertilization until scientists better understand the implications. [25]

In August 2018, Germany banned the sale of ocean seeding as carbon sequestration system [26] while the matter was under discussion at EU and EASAC levels. [27]

The marine food chain is based on photosynthesis by marine phytoplankton that combine carbon with inorganic nutrients to produce organic matter. Production is limited by the availability of nutrients, most commonly nitrogen or iron. Numerous experiments [28] have demonstrated how iron fertilization can increase phytoplankton productivity. Nitrogen is a limiting nutrient over much of the ocean and can be supplied from various sources, including fixation by cyanobacteria. Carbon-to-iron ratios in phytoplankton are much larger than carbon-to-nitrogen or carbon-to-phosphorus ratios, so iron has the highest potential for sequestration per unit mass added.

Oceanic carbon naturally cycles between the surface and the deep via two "pumps" of similar scale. The "solubility" pump is driven by ocean circulation and the solubility of CO2 in seawater. The "biological" pump is driven by phytoplankton and subsequent settling of detrital particles or dispersion of dissolved organic carbon. The former has increased as a result of increasing atmospheric CO2 집중. This CO2 sink is estimated to be approximately 2 GtC yr−1. [29]

The global phytoplankton population fell about 40 percent between 1950 and 2008 or about 1 percent per year. The most notable declines took place in polar waters and in the tropics. The decline is attributed to sea surface temperature increases. [30] A separate study found that diatoms, the largest type of phytoplankton, declined more than 1 percent per year from 1998 to 2012, particularly in the North Pacific, North Indian and Equatorial Indian oceans. The decline appears to reduce pytoplankton's ability to sequester carbon in the deep ocean. [31]

Fertilization offers the prospect of both reducing the concentration of atmospheric greenhouse gases with the aim of slowing climate change and at the same time increasing fish stocks via increasing primary production. The reduction reduces the ocean's rate of carbon sequestration in the deep ocean.

Each area of the ocean has a base sequestration rate on some timescale, e.g., annual. Fertilization must increase that rate, but must do so on a scale beyond the natural scale. Otherwise, fertilization changes the timing, but not the total amount sequestered. However, accelerated timing may have beneficial effects for primary production separate from those from sequestration. [29]

Biomass production inherently depletes all resources (save for sun and water). Either they must all be subject to fertilization or sequestration will eventually be limited by the one mostly slowly replenished (after some number of cycles) unless the ultimate limiting resource is sunlight and/or surface area. Generally, phosphate is the ultimate limiting nutrient. As oceanic phosphorus is depleted (via sequestration) it would have to be included in the fertilization cocktail supplied from terrestrial sources. [29]

"Ocean fertilisation options are only worthwhile if sustained on a millennial timescale and phosphorus addition may have greater long-term potential than iron or nitrogen fertilisation." [32] Phytoplankton require a variety of nutrients. These include macronutrients such as nitrate and phosphate (in relatively high concentrations) and micronutrients such as iron and zinc (in much smaller quantities). Nutrient requirements vary across phylogenetic groups (e.g., diatoms require silicon) but may not individually limit total biomass production. Co-limitation (among multiple nutrients) may also mean that one nutrient can partially compensate for a shortage of another. Silicon does not affect total production, but can change the timing and community structure with follow-on effects on remineralization times and subsequent mesopelagic.nutrient vertical distribution. [29]

High-nutrient, low-chlorophyll (LNLC) waters occupy the oceans' subtropical gyre systems, approximately 40 per cent of the surface, where wind-driven downwelling and a strong thermocline impede nutrient resupply from deeper water. Nitrogen fixation by cyanobacteria provides a major source of N. In effect, it ultimately prevents the ocean from losing the N required for photosynthesis. Phosphorus has no substantial supply route, making it the ultimate limiting macronutrient. The sources that fuel primary production are deep water stocks and runoff or dust-based. [29]

Iron Edit

Approximately 25 per cent of the ocean surface has ample macronutrients, with little plant biomass (as defined by chlorophyll). The production in these high-nutrient low-chlorophyll (HNLC) waters is primarily limited by micronutrients especially iron. [29] The cost of distributing iron over large ocean areas is large compared with the expected value of carbon credits. [33]

Phosphorus Edit

In the very long term, phosphorus "is often considered to be the ultimate limiting macronutrient in marine ecosystems" [34] and has a slow natural cycle. Where phosphate is the limiting nutrient in the photic zone, addition of phosphate is expected to increase primary phytoplankton production. This technique can give 0.83W/m 2 of globally averaged negative forcing, [32] which is sufficient to reverse the warming effect of about half the current levels of anthropogenic CO
2 배출. One water-soluble fertilizer is diammonium phosphate (DAP), (NH
4 )
2 HPO
4 , that as of 2008 had a market price of 1700/tonne−1 of phosphorus. Using that price and the C : P Redfield ratio of 106 : 1 produces a sequestration cost (excluding preparation and injection costs) of some $45 /tonne of carbon (2008), substantially less than the trading price for carbon emissions. [29]

Nitrogen Edit

This technique (proposed by Ian Jones) proposes to fertilize the ocean with urea, a nitrogen rich substance, to encourage phytoplankton growth. [35] This has also been considered by Karl. [36] Concentrations of macronutrients per area of ocean surface would be similar to large natural upwellings. Once exported from the surface, the carbon remains sequestered for a long time. [37]

An Australian company, Ocean Nourishment Corporation (ONC), planned to inject hundreds of tonnes of urea into the ocean, in order to boost the growth of CO
2 -absorbing phytoplankton, as a way to combat climate change. In 2007, Sydney-based ONC completed an experiment involving one tonne of nitrogen in the Sulu Sea off the Philippines. [38]

Macronutrient nourishment can give 0.38W/m 2 of globally averaged negative forcing, [32] which is sufficient to reverse the warming effect of current levels of around a quarter of anthropogenic CO
2 배출.

The Ocean Nourishment Corporation claimed, "One Ocean Nourishment plant will remove approximately 5–8 million tonnes of CO2 from the atmosphere for each year of operation, equivalent to offsetting annual emissions from a typical 1200 MW coal-fired power station or the short-term sequestration from one million hectares of new growth forest". [39]

The two dominant costs are manufacturing the nitrogen and nutrient delivery. [40]

Pelagic pumping Edit

Local wave power could be used to pump nutrient-rich water from hundred- metre-plus depths to the euphotic zone. However, deep water concentrations of dissolved CO2 could be returned to the atmosphere. [29]

The supply of DIC in upwelled water is generally sufficient for photosynthesis permitted by upwelled nutrients, without requiring atmospheric CO2. Second-order effects include how the composition of upwelled water differs from that of settling particles. More nitrogen than carbon is remineralized from sinking organic material. Upwelling of this water allows more carbon to sink than that in the upwelled water, which would make room for at least some atmospheric CO2 to be absorbed. the magnitude of this difference is unclear. No comprehensive studies have yet resolved this question. Preliminary calculations using upper limit assumptions indicate a low value. 1,000 square kilometres (390 sq mi) could sequester 1 gigatonne/year. [29]

Sequestration thus depends on the upward flux and the rate of lateral surface mixing of the surface water with denser pumped water. [29]

Volcanic ash Edit

Volcanic ash adds nutrients to the surface ocean. This is most apparent in nutrient-limited areas. Research on the effects of anthropogenic and aeolian iron addition to the ocean surface suggests that nutrient-limited areas benefit most from a combination of nutrients provided by anthropogenic, eolian and volcanic deposition. [41] Some oceanic areas are comparably limited in more than one nutrient, so fertilization regimes that includes all limited nutrients is more likely to succeed. Volcanic ash supplies multiple nutrients to the system, but excess metal ions can be harmful. The positive impacts of volcanic ash deposition are potentially outweighed by their potential to do harm. [ 인용 필요 ]

Clear evidence documents that ash can be as much as 45 percent by weight in some deep marine sediments. [42] [43] In the Pacific Ocean estimates claim that (on a millennial-scale) the atmospheric deposition of air-fall volcanic ash was as high as the deposition of desert dust. [44] This indicates the potential of volcanic ash as a significant iron source.

In August 2008 the Kasatochi volcanic eruption in the Aleutian Islands, Alaska, deposited ash in the nutrient-limited northeast Pacific. This ash (including iron) resulted in one of the largest phytoplankton blooms observed in the subarctic. [45] [46] Fisheries scientists in Canada linked increased oceanic productivity from the volcanic iron to subsequent record returns of salmon in the Fraser River two years later [47]

While manipulation of the land ecosystem in support of agriculture for the benefit of humans has long been accepted (despite its side effects), directly enhancing ocean productivity has not. Among the reasons are:

Outright opposition Edit

According to Lisa Speer of the Natural Resources Defense Council, "There is a limited amount of money, of time, that we have to deal with this problem. The worst possible thing we could do for climate change technologies would be to invest in something that doesn't work and that has big impacts that we don't anticipate." [48]

In 2009 Aaron Strong, Sallie Chisholm, Charles Miller and John Cullen opined in 자연 ". fertilizing the oceans with iron to stimulate phytoplankton blooms, absorb carbon dioxide from the atmosphere and export carbon to the deep sea — should be abandoned." [49]

Efficiency Edit

Algal cell chemical composition is often assumed to respect a ratio where atoms are 106 carbon: 16 nitrogen: 1 phosphorus (Redfield ratio [50] ): 0.0001 iron. In other words, each atom of iron helps capture 1,060,000 atoms of carbon, while one nitrogen atom only 6. [51]

In large areas of the ocean, such organic growth (and hence nitrogen fixation) is thought to be limited by the lack of iron rather than nitrogen, although direct measures are hard. [50]

On the other hand, experimental iron fertilisation in HNLC regions has been supplied with excess iron which cannot be utilized before it is scavenged. Thus the organic material produced was much less than if the ratio of nutrients above were achieved. Only a fraction of the available nitrogen (because of iron scavenging) is drawn down. In culture bottle studies of oligotrophic water, adding nitrogen and phosphorus can draw down considerably more nitrogen per dosing. The export production is only a small percentage of the new primary production and in the case of iron fertilization, iron scavenging means that regenerative production is small. With macronutrient fertilisation, regenerative production is expected to be large and supportive of larger total export. Other losses can also reduce efficiency. [52]

In addition, the efficiency of carbon sequestration through ocean fertilisation is heavily influenced by factors such as changes in stoichiometric ratios and gas exchange make accurately predicting the effectiveness of ocean feralization projects. [53]

Side effects Edit

According to Gnadesikan and Marinou, 2008, Beyond biological impacts, evidences suggests that plankton blooms can affect the physical properties of surface waters simply by absorbing light and heat from the sun. Watson added that if fertilization is done in shallow coastal waters, a dense layer of phytoplankton clouding the top 30 metres or so of the ocean could hinder corals, kelps or other deeper sea life from carrying out photosynthesis (Watson et al. 2008). In addition, as the bloom declines, nitrous oxide is released, potentially counteracting the effects from the sequestering of carbon. [54]

Algal blooms Edit

Toxic algal blooms are common in coastal areas. Fertilization could trigger such blooms. Chronic fertilization could risk the creation of dead zones, such as the one in the Gulf of Mexico. [15]

Impact on fisheries Edit

Adding urea to the ocean can cause phytoplankton blooms that serve as a food source for zooplankton and in turn feed for fish. This may increase fish catches. [55] However, if cyanobacteria and dinoflagellates dominate phytoplankton assemblages that are considered poor quality food for fish then the increase in fish quantity may not be large. [56] Some evidence links iron fertilization from volcanic eruptions to increased fisheries production. [47] [45] Other nutrients would be metabolized along with the added nutrient(s), reducing their presence in fertilized waters. [48]

Krill populations have declined dramatically since whaling began. [15] Sperm whales transport iron from the deep ocean to the surface during prey consumption and defecation. Sperm whales have been shown to increase the levels of primary production and carbon export to the deep ocean by depositing iron-rich faeces into surface waters of the Southern Ocean. The faeces causes phytoplankton to grow and take up carbon. The phytoplankton nourish krill. Reducing the abundance of sperm whales in the Southern Ocean, whaling resulted in an extra 2 million tonnes of carbon remaining in the atmosphere each year. [57]

Ecosystem disruption Edit

Many locations, such as the Tubbataha Reef in the Sulu Sea, support high marine biodiversity. [58] Nitrogen or other nutrient loading in coral reef areas can lead to community shifts towards algal overgrowth of corals and ecosystem disruption, implying that fertilization must be restricted to areas in which vulnerable populations are not put at risk. [59]

As the phytoplankton descend the water column, they decay, consuming oxygen and producing greenhouse gases methane and nitrous oxide. Plankton-rich surface waters could warm the surface layer, affecting circulation patterns. [48]

Cloud formation Edit

Many phytoplankton species release dimethyl sulfide (DMS), which escapes into the atmosphere where it forms sulfate aerosols and encourages cloud formation, which could reduce warming. [48] However, substantial increases in DMS could reduce global rainfall, according to global climate model simulations, while halving temperature increases as of 2100. [60] [61]

International law presents some dilemmas for ocean fertilization. [ 인용 필요 ] The United Nations Framework Convention on Climate Change (UNFCCC 1992) has accepted mitigation actions. [ 인용 필요 ] However, the UNFCCC and its revisions recognise only forestation and reforestation projects as carbon sinks. [ 인용 필요 ]

Law of the sea Edit

According to United Nations Convention on the Law of the Sea (LOSC 1982), all states are obliged to take all measures necessary to prevent, reduce and control pollution of the marine environment, to prohibit the transfer of damage or hazards from one area to another and to prohibit the transformation of one type pollution to another. How this relates to fertilization is undetermined. [62]

Fertilization may create sulfate aerosols that reflect sunlight, modifying the Earth's albedo, creating a cooling effect that reduces some of the effects of climate change. Enhancing the natural sulfur cycle in the Southern Ocean [63] by fertilizing with iron in order to enhance dimethyl sulfide production and cloud reflectivity may achieve this. [64] [65]


The Ammonia Transport, Retention and Futile Cycling Problem in Cyanobacteria

Ammonia is the preferred nitrogen source for many algae including the cyanobacterium Synechococcus elongatis (Synechococcus R-2 PCC 7942). Modelling ammonia uptake by cells is not straightforward because it exists in solution as NH3 and NH + 4 . NH3 is readily diffusible not only via the lipid bilayer but also through aquaporins and other more specific porins. On the other hand, NH + 4 requires cationic transporters to cross a membrane. Significant intracellular ammonia pools (≈1–10 mol m −3 ) are essential for the synthesis of amino acids from ammonia. The most common model envisaged for how cells take up ammonia and use it as a nitrogen source is the “pump–leak model” where uptake occurs through a simple diffusion of NH3 or through an energy-driven NH + 4 pump balancing a leak of NH3 out of the cell. The flaw in such models is that cells maintain intracellular pools of ammonia much higher than predicted by such models. With caution, [ 14 C]-methylamine can be used as an analogue tracer for ammonia and has been used to test various models of ammonia transport and metabolism. In this study, simple “proton trapping” accumulation by the diffusion of uncharged CH3NH2 has been compared to systems where CH3NH + 3 is taken up through channels, driven by the membrane potential (Δ i,o) or the electrochemical potential for Na + (Δμ나 + i,o ). No model can be reconciled with experimental data unless the permeability of CH3NH2 across the cell membrane is asymmetric: permeability into the cell is very high through gated porins, whereas permeability out of the cell is very low (≈40 nm s −1 ) and independent of the extracellular pH. The best model is a Na + ~에 /CH3NH + 3 ~에 co-porter driven by Δμ나 + i,o balancing synthesis of methylglutamine and a slow leak governed by Ficks law, and so there is significant futile cycling of methylamine across the cell membrane to maintain intracellular methylamine pools high enough for fixation by glutamine synthetase. The modified pump–leak model with asymmetric permeability of the uncharged form is a viable model for understanding ammonia uptake and retention in plants, free-living microbes and organisms in symbiotic relationships.

기관을 통해 액세스할 수 있는 구독 콘텐츠의 미리보기입니다.


장 검토

A micro-sphere is a tiny droplet that traps amino acids.

A ribozyme is a form of RNA with enzymatic properties

Strata are layers of sedimentary rock.

Mass extinctions have shaped the way the geologic time scale disorganized.

Eukaryotic cells are thought to have evolved by means of endosymbiosis.

Radiometric dating helps scientists to estimate the absolute age of a specimen.

씨. Hydrogen gas, ammonia, and methane

NS. Near hydrothermal vents

씨. Radioisotopes in rock surrounding the object.

NS. Between layer 2 and layer 3

Microspheres have short chains of amino acids organized into droplets. Cells have long chains of DNA that can replicate to form new cells.

An organism dies and is covered by sediment and when the organism decomposes, it leaves an impression in the sediment and in over time, the mold fills with sediment and forms a fossil.

Older strata are covered by younger strata meaning that older fossils lie below younger ones.

Reptiles, dinosaurs and birds evolved during the Mesozoic era and mammalian animals evolved during the Cenozoic era


BIOLOGY NOTES

Science (from Latin scientia - knowledge) refers to a system of acquiring knowledge – based on empiricism, experimentation, and methodological naturalism – aimed at finding out the truth. The basic unit of knowledge is the theory, which is a hypothesis that is predictive. The term science also refers to the organized body of knowledge humans have gained by such research.
Most scientists maintain that scientific investigation must adhere to the scientific method, a process for evaluating empirical knowledge under the working assumption of methodological materialism, which explains observable events in nature as a result of natural causes, rejecting supernatural notions. Less formally, the word science often describes any systematic field of study or the knowledge gained from it. Particular specialized studies that make use of empirical methods are often referred to as sciences as well. This article concentrates on the more specific definition.
Science as defined above is sometimes termed pure science to differentiate it from applied science, the application of research to human needs.


비디오 보기: იმუნური სისტემა (칠월 2022).


코멘트:

  1. Icelos

    물론 사과하지만이 대답은 나에게 적합하지 않습니다. 더 많은 옵션이 있습니까?

  2. Aethelberht

    가장 많은 포인트가 달성됩니다.

  3. Faris

    제 생각에는 이것은 잘못된 길입니다.

  4. Darby

    권위있는 대응, 유혹 ...

  5. Dael

    나는 이 주제에 대해 많은 이야기를 할 수 있다.



메시지 쓰기